Incidental Mutations

76 incidental mutations are currently displayed, and affect 76 genes.
16 are Possibly Damaging.
31 are Probably Damaging.
18 are Probably Benign.
10 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 76 of 76] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 101122 UTSW 4930433I11Rik 0.074 R1167 G1 225 N 7 40993579 D315V A T missense Het probably damaging 0.996 01/15/2014
2 101165 UTSW 4931440F15Rik 0.143 R1167 G1 225 N 11 29823567 R630H C T missense Het probably damaging 0.997 01/15/2014
3 101207 UTSW Acr 0.126 R1167 G1 225 N 15 89573974 I286T T C missense Het probably damaging 1.000 phenotype 01/15/2014
4 101080 UTSW Adnp 1.000 R1167 G1 225 N 2 168184500 S292P A G missense Het probably benign 0.111 phenotype 01/15/2014
5 101201 UTSW Apol6 0.050 R1167 G1 225 N 15 77047108 Y17* T A nonsense Het probably null phenotype 01/15/2014
6 101185 UTSW Arhgap22 0.000 R1167 G1 225 N 14 33343307 A G splice site 4 bp Het probably null phenotype 01/15/2014
7 101211 UTSW Bfar 0.092 R1167 G1 225 N 16 13698894 K202E A G missense Het possibly damaging 0.915 01/15/2014
8 101066 UTSW Bmpr2 1.000 R1167 G1 225 N 1 59859304 S470C A T missense Het probably damaging 1.000 phenotype 01/15/2014
9 101096 UTSW Cep135 1.000 R1167 G1 225 N 5 76624637 E623G A G missense Het probably damaging 1.000 phenotype 01/15/2014
10 101149 UTSW Clcn3 0.426 R1167 G1 225 N 8 60922788 A G critical splice donor site 2 bp Het probably null phenotype 01/15/2014
11 101114 UTSW Clptm1 0.940 R1167 G1 225 N 7 19634211 M523K A T missense Het probably damaging 0.999 01/15/2014
12 101106 UTSW Cyp26b1 1.000 R1167 G1 225 N 6 84584330 W117R A G missense Het probably damaging 1.000 phenotype 01/15/2014
13 101078 UTSW Dnmt3c 0.084 R1167 G1 225 N 2 153711781 T G critical splice donor site 2 bp Het probably null phenotype 01/15/2014
14 101060 UTSW Dst 0.284 R1167 G1 225 N 1 34223858 E2212G A G missense Het probably damaging 1.000 phenotype 01/15/2014
15 101138 UTSW Edrf1 0.587 R1167 G1 225 N 7 133644066 T238A A G missense Het probably benign 0.075 phenotype 01/15/2014
16 101179 UTSW Elmo1 0.000 R1167 G1 225 N 13 20185455 V10A T C missense Het probably damaging 0.998 phenotype 01/15/2014
17 101225 UTSW Ermp1 0.000 R1167 G1 225 N 19 29628679 S225P A G missense Het possibly damaging 0.529 phenotype 01/15/2014
18 101128 UTSW Fes 0.000 R1167 G1 185 N 7 80383109 L296Q A T missense Het probably damaging 1.000 phenotype 01/15/2014
19 101173 UTSW Foxn1 0.000 R1167 G1 225 N 11 78359066 N544K A T missense Het probably damaging 0.987 phenotype 01/15/2014
20 101203 UTSW Gga1 0.203 R1167 G1 225 N 15 78888170 N223K C G missense Het probably damaging 1.000 phenotype 01/15/2014
21 101153 UTSW Gm10608 0.082 R1167 G1 214 N 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA frame shift Het probably null 0.976 01/15/2014
22 101124 UTSW Gm4884 0.077 R1167 G1 225 N 7 41043912 Q435L A T missense Het possibly damaging 0.919 01/15/2014
23 101205 UTSW Gm8444 0.194 R1167 G1 216 N 15 81843380 T C unclassified Het probably benign 01/15/2014
24 101110 UTSW Gm8882 0.074 R1167 G1 225 N 6 132361590 P222S G A missense Het unknown 01/15/2014
25 101215 UTSW Ift140 1.000 R1167 G1 225 N 17 25035745 S131A T G missense Het probably benign 0.011 phenotype 01/15/2014
26 101187 UTSW Ipo4 0.153 R1167 G1 225 N 14 55635020 L88P A G missense Het probably damaging 1.000 01/15/2014
27 101136 UTSW Itgal 0.153 R1167 G1 225 N 7 127300939 S123N G A missense Het probably damaging 1.000 phenotype 01/15/2014
28 101084 UTSW Kcnn3 0.547 R1167 G1 225 N 3 89564952 Q344* C T nonsense Het probably null phenotype 01/15/2014
29 101140 UTSW Lrrc8e 0.156 R1167 G1 225 N 8 4235337 M521L A T missense Het probably benign 0.000 phenotype 01/15/2014
30 101169 UTSW Myocd 1.000 R1167 G1 225 N 11 65196377 D113E G T missense Het possibly damaging 0.773 phenotype 01/15/2014
31 101181 UTSW Nek4 0.339 R1167 G1 225 N 14 30974345 R499H G A missense Het possibly damaging 0.684 phenotype 01/15/2014
32 101217 UTSW Notch3 0.000 R1167 G1 194 N 17 32122745 D2011G T C missense Het possibly damaging 0.955 phenotype 01/15/2014
33 101074 UTSW Ola1 0.569 R1167 G1 225 N 2 73097194 V347A A G missense Het probably damaging 0.992 phenotype 01/15/2014
34 101076 UTSW Olfr1037 0.068 R1167 G1 225 N 2 86085291 V162A A G missense Het probably benign 0.161 phenotype 01/15/2014
35 101090 UTSW Olfr1339 0.074 R1167 G1 225 N 4 118734632 F34L C A missense Het possibly damaging 0.830 phenotype 01/15/2014
36 101161 UTSW Olfr790 0.111 R1167 G1 225 N 10 129501150 V89I G A missense Het probably benign 0.029 phenotype 01/15/2014
37 101091 UTSW Oxct2b 0.093 R1167 G1 225 N 4 123117585 T433A A G missense Het probably damaging 0.994 01/15/2014
38 101082 UTSW P2ry14 0.000 R1167 G1 225 N 3 59115131 R312G T C missense Het probably damaging 0.989 phenotype 01/15/2014
39 101183 UTSW Pbrm1 1.000 R1167 G1 225 N 14 31050142 N398D A G missense Het probably damaging 0.999 phenotype 01/15/2014
40 101068 UTSW Pdc 0.077 R1167 G1 225 N 1 150333245 Y160H T C missense Het probably damaging 1.000 phenotype 01/15/2014
41 101189 UTSW Pdlim2 0.083 R1167 G1 108 N 14 70164779 R296H C T missense Het probably damaging 1.000 0.801 phenotype 01/15/2014
42 101120 UTSW Pop4 1.000 R1167 G1 225 N 7 38263269 D190E A T missense Het probably benign 0.337 phenotype 01/15/2014
43 101155 UTSW R3hdm4 0.081 R1167 G1 225 N 10 79912073 A G critical splice donor site 2 bp Het probably null 01/15/2014
44 101163 UTSW Rab1a 0.834 R1167 G1 225 N 11 20223172 T91K C A missense Het possibly damaging 0.925 phenotype 01/15/2014
45 101223 UTSW Rad9a 1.000 R1167 G1 225 N 19 4197502 V215A A G missense Het possibly damaging 0.906 phenotype 01/15/2014
46 101159 UTSW Rassf3 0.140 R1167 G1 225 N 10 121416254 V84A A G missense Het probably damaging 1.000 phenotype 01/15/2014
47 101062 UTSW Rftn2 0.000 R1167 G1 225 N 1 55204299 T270M G A missense Het probably damaging 1.000 01/15/2014
48 101108 UTSW Rho 0.118 R1167 G1 173 N 6 115935423 T100A A G missense Het probably damaging 0.975 phenotype 01/15/2014
49 101102 UTSW Rnft2 0.000 R1167 G1 225 N 5 118228882 I264V T C missense Het possibly damaging 0.942 01/15/2014
50 101151 UTSW Robo3 1.000 R1167 G1 225 N 9 37423907 Y567* A T nonsense Het probably null phenotype 01/15/2014
51 262429 UTSW Rpp14 0.951 R1167 G1 225 N 14 8083705 T A splice site Het probably null 02/04/2015
52 101154 UTSW Rtkn2 0.121 R1167 G1 225 N 10 67997620 S98P T C missense Het probably damaging 1.000 01/15/2014
53 101177 UTSW Ryr2 1.000 R1167 G1 225 N 13 11660113 V3376A A G missense Het possibly damaging 0.942 phenotype 01/15/2014
54 101134 UTSW Sbf2 0.421 R1167 G1 225 N 7 110364549 W1030R A T missense Het probably damaging 0.998 phenotype 01/15/2014
55 101221 UTSW Setbp1 0.562 R1167 G1 225 N 18 78857236 A1072V G A missense Het possibly damaging 0.848 phenotype 01/15/2014
56 101072 UTSW Slc4a10 0.000 R1167 G1 225 N 2 62228574 K142E A G missense Het probably damaging 1.000 phenotype 01/15/2014
57 101199 UTSW Slc52a2 1.000 R1167 G1 225 N 15 76539591 E40G A G missense Het probably benign 0.055 phenotype 01/15/2014
58 101112 UTSW Slc8a2 0.150 R1167 G1 225 N 7 16157387 N784S A G missense Het possibly damaging 0.584 phenotype 01/15/2014
59 101064 UTSW Spats2l 0.157 R1167 G1 225 N 1 57943111 Q384L A T missense Het probably damaging 0.996 01/15/2014
60 101092 UTSW Steap4 0.107 R1167 G1 225 N 5 7976520 K161T A C missense Het probably benign 0.336 phenotype 01/15/2014
61 101132 UTSW Taf10 1.000 R1167 G1 225 N 7 105743231 S188G T C missense Het probably benign 0.001 phenotype 01/15/2014
62 101191 UTSW Tbc1d4 0.000 R1167 G1 225 N 14 101608019 D148N C T missense Het probably damaging 0.997 phenotype 01/15/2014
63 101167 UTSW Tenm2 0.515 R1167 G1 225 N 11 36864684 K162N T G missense Het probably benign 0.301 phenotype 01/15/2014
64 101118 UTSW Tmem147 0.941 R1167 G1 225 N 7 30727796 V146A A G missense Het probably benign 0.326 01/15/2014
65 101088 UTSW Tnfsf8 0.000 R1167 G1 225 N 4 63837086 S100P A G missense Het possibly damaging 0.546 phenotype 01/15/2014
66 101104 UTSW Trim56 0.000 R1167 G1 225 N 5 137112520 Y714C T C missense Het probably damaging 0.980 01/15/2014
67 101143 UTSW Ubxn8 0.079 R1167 G1 144 N 8 33641901 S13P A G missense Het probably damaging 0.974 phenotype 01/15/2014
68 101219 UTSW Usp49 0.154 R1167 G1 225 N 17 47672226 D52G A G missense Het possibly damaging 0.945 01/15/2014
69 101147 UTSW Vegfc 1.000 R1167 G1 225 N 8 54186043 Y408S A C missense Het probably benign 0.062 phenotype 01/15/2014
70 101130 UTSW Vmn2r77 0.079 R1167 G1 225 N 7 86801746 N280S A G missense Het probably benign 0.019 01/15/2014
71 101100 UTSW Vmn2r8 0.069 R1167 G1 225 N 5 108803176 L134F T A missense Het probably benign 0.008 01/15/2014
72 101098 UTSW Wdfy3 0.936 R1167 G1 225 N 5 101875931 I2437F T A missense Het probably benign 0.000 phenotype 01/15/2014
73 101145 UTSW Wwc2 0.085 R1167 G1 225 N 8 47858779 L783* A T nonsense Het probably null phenotype 01/15/2014
74 101070 UTSW Zer1 0.199 R1167 G1 225 N 2 30108246 R351H C T missense Het probably benign 0.003 phenotype 01/15/2014
75 101126 UTSW Zfp715 0.085 R1167 G1 225 N 7 43298437 F700I A T missense Het possibly damaging 0.828 01/15/2014
76 101213 UTSW Zfp995 0.060 R1167 G1 225 N 17 21879979 H425Y G A missense Het probably damaging 1.000 01/15/2014
[records 1 to 76 of 76]