Incidental Mutations

18 incidental mutations are currently displayed, and affect 18 genes.
1 are Possibly Damaging.
6 are Probably Damaging.
7 are Probably Benign.
4 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 18 of 18] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 150857 UTSW 1110034G24Rik 0.000 R1275 G1 225 N 2 132692095 S48P T C missense Het probably benign 0.000 01/29/2014
2 150863 UTSW 1700123L14Rik 0.657 R1275 G1 98 N 6 96165118 E315G T C missense Het probably benign 0.031 01/29/2014
3 150869 UTSW Clstn2 0.000 R1275 G1 225 N 9 97457430 V793I C T missense Het probably benign 0.005 phenotype 01/29/2014
4 150864 UTSW Coro1a 0.000 R1275 G1 225 N 7 126700583 C T critical splice donor site 1 bp Het probably null phenotype 01/29/2014
5 150871 UTSW Dync1h1 1.000 R1275 G1 225 N 12 110636509 E2195K G A missense Het probably benign 0.044 0.065 phenotype 01/29/2014
6 150859 UTSW Efcab14 0.000 R1275 G1 225 N 4 115756473 L206R T G missense Het probably damaging 1.000 01/29/2014
7 150855 UTSW Ehmt1 1.000 R1275 G1 225 N 2 24886995 A G critical splice donor site 2 bp Het probably null phenotype 01/29/2014
8 150860 UTSW Fosl2 1.000 R1275 G1 152 N 5 32150454 R130W C T missense Het probably damaging 1.000 phenotype 01/29/2014
9 150868 UTSW Gfral 0.067 R1275 G1 225 N 9 76197032 C233R A G missense Het probably damaging 1.000 phenotype 01/29/2014
10 150873 UTSW Gm281 0.068 R1275 G1 225 N 14 13896949 Y142C T C missense Het probably damaging 1.000 01/29/2014
11 150856 UTSW Ino80 0.957 R1275 G1 225 N 2 119427055 T765A T C missense Het probably benign 0.116 phenotype 01/29/2014
12 150854 UTSW Mindy3 0.154 R1275 G1 225 N 2 12396173 A T splice site 6 bp Het probably null phenotype 01/29/2014
13 150870 UTSW Myo15b 0.062 R1275 G1 108 N 11 115883492 CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG small deletion Het probably benign 01/29/2014
14 150874 UTSW Osbpl11 1.000 R1275 G1 225 N 16 33185850 M16K T A missense Het probably benign 0.099 phenotype 01/29/2014
15 150865 UTSW Rassf7 0.102 R1275 G1 184 N 7 141217147 L91Q T A missense Het probably damaging 0.999 01/29/2014
16 150858 UTSW Unc13b 0.236 R1275 G1 106 N 4 43235366 K3318R A G missense Het probably damaging 0.995 phenotype 01/29/2014
17 150875 UTSW Vmn1r234 0.048 R1275 G1 217 N 17 21229251 CTT CTTT frame shift Het probably null 01/29/2014
18 150866 UTSW Zfp930 0.000 R1275 G1 225 N 8 69227979 K108E A G missense Het possibly damaging 0.726 01/29/2014
[records 1 to 18 of 18]