Incidental Mutations

21 incidental mutations are currently displayed, and affect 21 genes.
3 are Possibly Damaging.
11 are Probably Damaging.
5 are Probably Benign.
2 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 21 of 21] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 156886 UTSW Asah2 0.353 R1336 G1 225 N 19 32044941 I231T A G missense Het probably damaging 0.995 0.791 phenotype 02/11/2014
2 156867 UTSW Bbs7 0.000 R1336 G1 225 N 3 36604444 I227T A G missense Het probably benign 0.000 phenotype 02/11/2014
3 156865 UTSW Ccdc141 0.000 R1336 G1 225 N 2 77014440 T1428A T C missense Het probably damaging 0.997 0.201 phenotype 02/11/2014
4 156872 UTSW Chsy1 0.000 R1336 G1 225 N 7 66125239 C A splice site Het probably null phenotype 02/11/2014
5 156882 UTSW Cox16 0.102 R1336 G1 225 N 12 81472290 D89G T C missense Het probably damaging 1.000 0.158 02/11/2014
6 156881 UTSW Dnah17 0.000 R1336 G1 150 N 11 118043215 I3511T A G missense Het possibly damaging 0.698 0.137 phenotype 02/11/2014
7 156868 UTSW Dpy19l4 0.089 R1336 G1 225 N 4 11276901 Y333N A T missense Het probably damaging 0.999 0.429 02/11/2014
8 156862 UTSW Fcrl6 0.000 R1336 G1 225 N 1 172599224 Q52* G A nonsense Het probably null 02/11/2014
9 156869 UTSW Fgl2 0.231 R1336 G1 137 N 5 21373183 L156Q T A missense Het possibly damaging 0.524 phenotype 02/11/2014
10 156870 UTSW Fras1 0.000 R1336 G1 225 N 5 96707308 D1892G A G missense Het probably benign 0.003 0.069 phenotype 02/11/2014
11 156874 UTSW Ogfod1 0.000 R1336 G1 225 N 8 94058099 C344R T C missense Het probably damaging 0.999 0.709 phenotype 02/11/2014
12 156887 UTSW Papss2 0.205 R1336 G1 225 N 19 32638315 V149A T C missense Het possibly damaging 0.730 phenotype 02/11/2014
13 156861 UTSW Plekhm3 0.167 R1336 G1 104 N 1 64937781 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC small deletion Het probably benign 02/11/2014
14 156875 UTSW Pmfbp1 0.120 R1336 G1 225 N 8 109530266 I534S T G missense Het probably damaging 0.998 0.130 02/11/2014
15 156864 UTSW Rif1 1.000 R1336 G1 225 N 2 52078314 W170R T A missense Het probably benign 0.063 0.090 phenotype 02/11/2014
16 156878 UTSW Ros1 0.188 R1336 G1 225 N 10 52168662 T183I G A missense Het probably damaging 1.000 phenotype 02/11/2014
17 156885 UTSW Snx4 0.187 R1336 G1 179 N 16 33280680 I234T T C missense Het probably benign 0.204 phenotype 02/11/2014
18 156871 UTSW Sptbn4 0.656 R1336 G1 117 N 7 27417963 S454P A G missense Het probably damaging 0.999 phenotype 02/11/2014
19 156866 UTSW Stard9 0.230 R1336 G1 225 N 2 120673636 S221R C A missense Het probably damaging 1.000 0.506 02/11/2014
20 156863 UTSW Uck1 0.000 R1336 G1 115 N 2 32259654 D71G T C missense Het probably damaging 0.998 0.930 phenotype 02/11/2014
21 156883 UTSW Vcan 1.000 R1336 G1 225 N 13 89693055 E497K C T missense Het probably damaging 0.998 0.104 phenotype 02/11/2014
[records 1 to 21 of 21]