Incidental Mutations

23 incidental mutations are currently displayed, and affect 23 genes.
1 are Possibly Damaging.
13 are Probably Damaging.
7 are Probably Benign.
1 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 23 of 23] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 162923 UTSW Acap2 0.167 R1377 G1 225 N 16 31116051 V363A A G missense Het probably damaging 0.995 03/17/2014
2 162922 UTSW Arc 1.000 R1377 G1 221 N 15 74672252 H41Y G A missense Het possibly damaging 0.507 phenotype 03/17/2014
3 162909 UTSW Atp7b 0.685 R1377 G1 225 N 8 22011785 A854V G A missense Het probably benign 0.172 phenotype 03/17/2014
4 162916 UTSW Ccng1 0.316 R1377 G1 225 N 11 40752114 P169S G A missense Het probably benign 0.020 0.059 phenotype 03/17/2014
5 162925 UTSW Dnah8 0.500 R1377 G1 225 N 17 30840622 K4399* A T nonsense Het probably null phenotype 03/17/2014
6 162924 UTSW Dscam 1.000 R1377 G1 225 N 16 96772494 V756A A G missense Het probably damaging 0.996 phenotype 03/17/2014
7 162920 UTSW Exoc3l4 0.080 R1377 G1 225 N 12 111428670 E574V A T missense Het probably damaging 1.000 03/17/2014
8 162907 UTSW Fbxo46 0.121 R1377 G1 225 N 7 19136425 V323E T A missense Het probably damaging 0.997 phenotype 03/17/2014
9 162918 UTSW Gria1 0.000 R1377 G1 225 N 11 57201176 N163K C A missense Het probably damaging 1.000 phenotype 03/17/2014
10 162921 UTSW Has2 1.000 R1377 G1 225 N 15 56681806 I133M T C missense Het probably damaging 1.000 phenotype 03/17/2014
11 162908 UTSW Itgal 0.155 R1377 G1 225 N 7 127321917 L750Q T A missense Het probably damaging 0.999 phenotype 03/17/2014
12 162913 UTSW Ptprk 0.000 R1377 G1 225 N 10 28586026 R1195Q G A missense Het probably benign 0.421 phenotype 03/17/2014
13 162904 UTSW Rbm15 1.000 R1377 G1 225 N 3 107330758 T775A T C missense Het probably benign 0.000 phenotype 03/17/2014
14 162912 UTSW Rbpms2 0.000 R1377 G1 217 N 9 65651666 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC unclassified Het probably benign 0.090 phenotype 03/17/2014
15 162911 UTSW Sipa1l2 0.288 R1377 G1 225 N 8 125491977 E207G T C missense Het probably damaging 0.997 phenotype 03/17/2014
16 162919 UTSW Slc38a6 0.093 R1377 G1 225 N 12 73350571 I329N T A missense Het probably damaging 0.975 03/17/2014
17 162903 UTSW Stoml3 0.139 R1377 G1 225 N 3 53507641 A285T G A missense Het probably benign 0.000 phenotype 03/17/2014
18 162910 UTSW Trhr2 0.091 R1377 G1 225 N 8 122360588 V38M C T missense Het probably damaging 0.998 03/17/2014
19 162902 UTSW Trp53bp1 0.000 R1377 G1 225 N 2 121270642 L25P A G missense Het probably damaging 1.000 phenotype 03/17/2014
20 162926 UTSW Wdr33 0.955 R1377 G1 125 N 18 31888641 M748K T A missense Het unknown phenotype 03/17/2014
21 162917 UTSW Zfp454 0.069 R1377 G1 225 N 11 50873780 Y164C T C missense Het probably damaging 1.000 03/17/2014
22 162900 UTSW Zfp804a 0.225 R1377 G1 225 N 2 82258497 V890A T C missense Het probably benign 0.394 phenotype 03/17/2014
23 162906 UTSW Zxdc 0.123 R1377 G1 181 N 6 90378903 S465P T C missense Het probably damaging 0.998 0.251 03/17/2014
[records 1 to 23 of 23]