Incidental Mutations

95 incidental mutations are currently displayed, and affect 95 genes.
16 are Possibly Damaging.
30 are Probably Damaging.
38 are Probably Benign.
10 are Probably Null.
2 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 95 of 95] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 158765 UTSW 1700061I17Rik 0.069 R1445 G1 225 Y 3 117067736 G T exon Het noncoding transcript 03/14/2014
2 158811 UTSW 2300003K06Rik 0.061 R1445 G1 211 Y 11 99837967 Q17K G T missense Het probably benign 0.032 0.101 03/14/2014
3 158789 UTSW Abca16 0.000 R1445 G1 225 Y 7 120520033 V999A T C missense Het probably benign 0.406 0.090 03/14/2014
4 158832 UTSW Actn3 0.401 R1445 G1 81 Y 19 4865455 C T unclassified Het probably benign phenotype 03/14/2014
5 158802 UTSW Agap2 0.454 R1445 G1 225 Y 10 127091112 T A splice site Het probably benign phenotype 03/14/2014
6 158773 UTSW Ago3 0.000 R1445 G1 225 Y 4 126371787 R278L C A missense Het probably benign 0.000 0.733 phenotype 03/14/2014
7 158796 UTSW Aldh1a2 1.000 R1445 G1 225 Y 9 71285210 V449A T C missense Het possibly damaging 0.819 0.461 phenotype 03/14/2014
8 158776 UTSW Alkbh2 0.000 R1445 G1 225 Y 5 114124226 E148K C T missense Het probably damaging 0.979 0.223 phenotype 03/14/2014
9 158752 UTSW Aplnr 1.000 R1445 G1 221 Y 2 85137009 Y126C A G missense Het probably damaging 1.000 0.713 phenotype 03/14/2014
10 158812 UTSW Apob 0.908 R1445 G1 225 Y 12 8016084 I4351T T C missense Het possibly damaging 0.483 0.148 phenotype 03/14/2014
11 158763 UTSW Ash1l 1.000 R1445 G1 225 Y 3 89007352 L1763P T C missense Het probably benign 0.023 0.090 phenotype 03/14/2014
12 158818 UTSW Aspn 0.000 R1445 G1 225 Y 13 49557373 S165P T C missense Het possibly damaging 0.749 0.108 phenotype 03/14/2014
13 158753 UTSW Atg13 1.000 R1445 G1 159 Y 2 91679990 V349E A T missense Het probably damaging 0.991 0.647 phenotype 03/14/2014
14 158808 UTSW Atp1b2 0.836 R1445 G1 225 Y 11 69602483 T A critical splice acceptor site Het probably null 0.948 phenotype 03/14/2014
15 158778 UTSW B3glct 0.286 R1445 G1 152 Y 5 149754139 D411V A T missense Het probably damaging 1.000 0.956 phenotype 03/14/2014
16 158766 UTSW Bcar3 0.638 R1445 G1 139 Y 3 122523191 I255F A T missense Het probably damaging 0.979 0.215 phenotype 03/14/2014
17 158749 UTSW Cacna1b 0.000 R1445 G1 225 Y 2 24718136 G A splice site Het probably benign phenotype 03/14/2014
18 158795 UTSW Cep164 1.000 R1445 G1 225 Y 9 45778900 E675A T G missense Het possibly damaging 0.659 0.179 phenotype 03/14/2014
19 158764 UTSW Chd1l 0.272 R1445 G1 225 Y 3 97582731 E503K C T missense Het probably benign 0.013 0.090 phenotype 03/14/2014
20 158784 UTSW Chst8 0.000 R1445 G1 133 Y 7 34748168 M8I C A missense Het possibly damaging 0.951 0.155 phenotype 03/14/2014
21 158780 UTSW Clec4n 0.000 R1445 G1 225 Y 6 123235516 E67G A G missense Het probably benign 0.009 0.086 phenotype 03/14/2014
22 158750 UTSW Cobll1 0.320 R1445 G1 225 Y 2 65099136 D653E A T missense Het probably damaging 1.000 0.108 03/14/2014
23 158745 UTSW Col9a1 0.137 R1445 G1 225 N 1 24237498 T C critical splice donor site 2 bp Het probably null phenotype 03/14/2014
24 158814 UTSW Crip2 0.000 R1445 G1 141 Y 12 113143504 L30P T C missense Het probably damaging 1.000 0.868 phenotype 03/14/2014
25 158775 UTSW Ctbp1 0.946 R1445 G1 225 Y 5 33261063 V22I C T missense Het probably benign 0.012 0.147 phenotype 03/14/2014
26 158751 UTSW Cwc22 1.000 R1445 G1 211 Y 2 77917177 T C splice site Het probably benign 03/14/2014
27 158771 UTSW Cyp4a32 0.092 R1445 G1 225 Y 4 115602950 Y119* C A nonsense Het probably null 0.964 03/14/2014
28 158760 UTSW Dido1 0.960 R1445 G1 225 Y 2 180671470 A463E G T missense Het possibly damaging 0.622 0.179 phenotype 03/14/2014
29 158746 UTSW Dnah7a 0.121 R1445 G1 225 Y 1 53528797 P1880L G A missense Het probably benign 0.019 0.102 03/14/2014
30 158807 UTSW Dock2 0.000 R1445 G1 198 Y 11 34239705 T1489S T A missense Het probably benign 0.000 0.187 phenotype 03/14/2014
31 158816 UTSW Dsp 1.000 R1445 G1 225 Y 13 38191931 T1231A A G missense Het probably damaging 0.984 0.093 phenotype 03/14/2014
32 158777 UTSW Eif2ak1 0.150 R1445 G1 100 Y 5 143873899 G T splice site Het probably benign 0.090 phenotype 03/14/2014
33 158831 UTSW Epc1 1.000 R1445 G1 225 Y 18 6452360 M233K A T missense Het probably damaging 1.000 0.145 phenotype 03/14/2014
34 158835 UTSW Fam189a2 0.077 R1445 G1 225 Y 19 24021634 T140M G A missense Het probably damaging 1.000 0.647 03/14/2014
35 158747 UTSW Gigyf2 0.943 R1445 G1 225 Y 1 87443638 A G splice site Het probably benign phenotype 03/14/2014
36 158813 UTSW Greb1 0.000 R1445 G1 225 Y 12 16707851 H58P T G missense Het probably damaging 1.000 0.491 phenotype 03/14/2014
37 158824 UTSW Gtpbp1 0.000 R1445 G1 200 Y 15 79713448 I348T T C missense Het possibly damaging 0.824 0.184 phenotype 03/14/2014
38 158757 UTSW Hck 0.467 R1445 G1 225 Y 2 153128272 N64Y A T missense Het probably benign 0.011 0.090 phenotype 03/14/2014
39 158786 UTSW Herc2 0.953 R1445 G1 225 Y 7 56168996 S2812P T C missense Het probably damaging 0.997 0.324 phenotype 03/14/2014
40 262783 UTSW Inpp4b 0.428 R1445 G1 96 N 8 81952834 T A intron 42 bp Het probably null phenotype 02/04/2015
41 158744 UTSW Kcnq5 0.503 R1445 G1 225 Y 1 21405024 S473A A C missense Het probably benign 0.010 0.072 phenotype 03/14/2014
42 158762 UTSW Lrat 0.128 R1445 G1 225 Y 3 82903369 D115A T G missense Het probably damaging 0.999 0.639 phenotype 03/14/2014
43 158815 UTSW Lyst 0.248 R1445 G1 225 Y 13 13640054 I1131M A G missense Het possibly damaging 0.941 0.082 phenotype 03/14/2014
44 158787 UTSW Man2a2 0.292 R1445 G1 157 Y 7 80368562 D160G T C missense Het probably benign 0.058 0.109 phenotype 03/14/2014
45 158825 UTSW Marf1 0.232 R1445 G1 119 Y 16 14115824 D1567N C T missense Het probably benign 0.000 0.090 phenotype 03/14/2014
46 158803 UTSW Mars 0.966 R1445 G1 225 Y 10 127297988 D680G T C missense Het possibly damaging 0.747 0.158 phenotype 03/14/2014
47 158820 UTSW Mat1a 0.152 R1445 G1 225 Y 14 41121840 S339P T C missense Het probably damaging 1.000 0.620 phenotype 03/14/2014
48 158782 UTSW Megf8 0.936 R1445 G1 138 Y 7 25342656 S1300P T C missense Het probably damaging 0.967 0.236 phenotype 03/14/2014
49 158754 UTSW Mga 0.945 R1445 G1 225 Y 2 119902698 L9S T C missense Het probably damaging 1.000 0.419 phenotype 03/14/2014
50 158809 UTSW Mllt6 0.000 R1445 G1 169 Y 11 97672451 T C splice site Het probably benign phenotype 03/14/2014
51 158770 UTSW Mrpl37 0.953 R1445 G1 225 Y 4 107064495 L179P A G missense Het probably benign 0.003 0.090 phenotype 03/14/2014
52 158791 UTSW Mtnr1a 0.000 R1445 G1 225 Y 8 45087745 V248L G T missense Het probably benign 0.273 0.090 phenotype 03/14/2014
53 158826 UTSW Mylk 0.000 R1445 G1 225 Y 16 34815465 S19P T C missense Het possibly damaging 0.567 0.118 phenotype 03/14/2014
54 158821 UTSW Olfr738 0.088 R1445 G1 225 Y 14 50414401 T286A A G missense Het probably damaging 0.998 0.647 phenotype 03/14/2014
55 158819 UTSW Parp8 0.000 R1445 G1 183 Y 13 117025350 A T utr 5 prime Het probably null 03/14/2014
56 254676 UTSW Pcnx2 0.000 R1445 G1 49 Y 8 125752284 D2075G T C missense Het probably damaging 0.987 0.075 phenotype 12/05/2014
57 158768 UTSW Pigo 1.000 R1445 G1 170 Y 4 43021460 I494K A T missense Het probably benign 0.000 0.090 phenotype 03/14/2014
58 158804 UTSW Pkd1l1 1.000 R1445 G1 196 Y 11 8870313 D1217E A T missense Het probably benign 0.002 0.090 phenotype 03/14/2014
59 158823 UTSW Pkhd1l1 0.000 R1445 G1 225 Y 15 44505644 V895A T C missense Het probably benign 0.323 0.138 03/14/2014
60 158755 UTSW Plcb4 0.000 R1445 G1 187 Y 2 136000189 H1031L A T missense Het possibly damaging 0.899 0.211 phenotype 03/14/2014
61 158799 UTSW Plxnb1 0.000 R1445 G1 144 Y 9 109108921 K1245R A G missense Het probably null 0.000 0.098 phenotype 03/14/2014
62 158785 UTSW Pold1 0.961 R1445 G1 129 Y 7 44542757 C T splice site Het probably benign phenotype 03/14/2014
63 158801 UTSW Ptprq 0.446 R1445 G1 225 Y 10 107662562 I885V T C missense Het probably damaging 1.000 0.248 phenotype 03/14/2014
64 158779 UTSW Ptprz1 0.630 R1445 G1 225 Y 6 23050474 D1398G A G missense Het probably damaging 1.000 0.933 phenotype 03/14/2014
65 158833 UTSW Pygm 0.000 R1445 G1 225 Y 19 6389887 A364T G A missense Het probably benign 0.203 0.095 phenotype 03/14/2014
66 158758 UTSW Rbl1 0.000 R1445 G1 225 Y 2 157193098 N354S T C missense Het probably benign 0.000 0.072 phenotype 03/14/2014
67 158783 UTSW Scgb2b19 0.033 R1445 G1 225 Y 7 33279612 C T critical splice donor site 1 bp Het probably null 0.976 03/14/2014
68 158829 UTSW Slc26a8 0.541 R1445 G1 225 Y 17 28648213 V545M C T missense Het possibly damaging 0.719 0.179 phenotype 03/14/2014
69 254675 UTSW Slc27a1 0.179 R1445 G1 80 Y 8 71584113 T A splice site Het probably null 0.976 phenotype 12/05/2014
70 158788 UTSW Smpd1 0.259 R1445 G1 225 Y 7 105556674 D416G A G missense Het possibly damaging 0.820 0.122 phenotype 03/14/2014
71 158822 UTSW Sorbs3 0.000 R1445 G1 225 N 14 70193646 V284A A G missense Het probably benign 0.124 phenotype 03/14/2014
72 158827 UTSW Stfa2l1 0.051 R1445 G1 225 Y 16 36161784 V75A T C missense Het probably damaging 0.983 0.645 03/14/2014
73 158756 UTSW Syndig1 0.154 R1445 G1 159 Y 2 149930921 D166G A G missense Het probably damaging 0.998 0.101 phenotype 03/14/2014
74 254677 UTSW Tcp10a 0.093 R1445 G1 32 Y 17 7326007 G A critical splice donor site 1 bp Het probably null 0.976 12/05/2014
75 158774 UTSW Themis2 0.000 R1445 G1 225 Y 4 132782901 I663F T A missense Het possibly damaging 0.533 0.179 phenotype 03/14/2014
76 158772 UTSW Thrap3 0.909 R1445 G1 225 Y 4 126176336 Q586R T C missense Het probably damaging 0.998 0.081 03/14/2014
77 158797 UTSW Tinag 0.088 R1445 G1 225 Y 9 77045516 C62F C A missense Het probably damaging 1.000 0.907 phenotype 03/14/2014
78 158748 UTSW Tmem206 0.073 R1445 G1 225 Y 1 191348362 A G unclassified Het probably benign 03/14/2014
79 158769 UTSW Tmod1 1.000 R1445 G1 191 Y 4 46090884 Y146H T C missense Het probably damaging 0.999 0.388 phenotype 03/14/2014
80 158794 UTSW Tmprss4 0.070 R1445 G1 225 Y 9 45184385 I54F T A missense Het possibly damaging 0.589 0.073 phenotype 03/14/2014
81 158790 UTSW Tnks 0.000 R1445 G1 180 Y 8 34834603 A C splice site Het probably benign phenotype 03/14/2014
82 158798 UTSW Trim43a 0.115 R1445 G1 191 Y 9 88582989 GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT intron Het probably benign 0.090 03/14/2014
83 158793 UTSW Trpc6 0.000 R1445 G1 225 Y 9 8680537 E844G A G missense Het probably benign 0.001 0.058 phenotype 03/14/2014
84 158806 UTSW Ubtd2 0.814 R1445 G1 174 Y 11 32516125 R115W C T missense Het probably damaging 1.000 0.647 03/14/2014
85 158830 UTSW Ubxn6 0.179 R1445 G1 225 Y 17 56069042 D373G T C missense Het probably benign 0.134 0.070 03/14/2014
86 158792 UTSW Upf1 0.967 R1445 G1 210 Y 8 70341524 Q244L T A missense Het probably benign 0.002 0.142 phenotype 03/14/2014
87 158767 UTSW Usp33 0.753 R1445 G1 225 Y 3 152368634 I372M A G missense Het probably damaging 0.994 0.212 phenotype 03/14/2014
88 158805 UTSW Usp34 0.781 R1445 G1 225 Y 11 23351629 E351G A G missense Het probably damaging 0.993 0.220 03/14/2014
89 158800 UTSW Utrn 0.000 R1445 G1 150 Y 10 12678574 A G splice site Het probably benign phenotype 03/14/2014
90 158781 UTSW Vmn1r78 0.062 R1445 G1 225 Y 7 12152581 K40E A G missense Het possibly damaging 0.645 0.179 03/14/2014
91 158761 UTSW Vmn2r7 0.080 R1445 G1 225 Y 3 64724802 M80L T A missense Het probably benign 0.010 0.090 03/14/2014
92 158834 UTSW Vps13a 0.000 R1445 G1 225 Y 19 16701238 Y1126* G T nonsense Het probably null 0.976 phenotype 03/14/2014
93 158759 UTSW Wfdc11 0.000 R1445 G1 225 Y 2 164664446 N60S T C missense Het probably benign 0.078 0.278 03/14/2014
94 158817 UTSW Wnk2 0.481 R1445 G1 225 N 13 49071110 D992N C T missense Het probably damaging 0.999 phenotype 03/14/2014
95 158810 UTSW Zpbp2 0.285 R1445 G1 225 Y 11 98553844 T66K C A missense Het probably damaging 1.000 0.647 phenotype 03/14/2014
[records 1 to 95 of 95]