Incidental Mutations

67 incidental mutations are currently displayed, and affect 67 genes.
12 are Possibly Damaging.
22 are Probably Damaging.
21 are Probably Benign.
11 are Probably Null.
5 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 67 of 67] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 186708 UTSW A1cf 0.104 R1660 G1 225 N 19 31893107 S3* C A nonsense Het probably null phenotype 05/09/2014
2 186687 UTSW Adgrv1 0.000 R1660 G1 225 N 13 81476631 V3740I C T missense Het probably benign 0.003 phenotype 05/09/2014
3 186638 UTSW Aida 0.287 R1660 G1 205 N 1 183297583 F22S T C missense Het probably damaging 1.000 05/09/2014
4 186651 UTSW Ankrd65 0.146 R1660 G1 225 N 4 155792071 D220V A T missense Het probably damaging 0.979 05/09/2014
5 186654 UTSW Antxr2 0.094 R1660 G1 225 N 5 97975350 C279* A T nonsense Het probably null phenotype 05/09/2014
6 186688 UTSW Ap3b1 0.652 R1660 G1 225 N 13 94408812 V191A T C missense Het probably damaging 0.980 phenotype 05/09/2014
7 186689 UTSW Arhgef28 0.000 R1660 G1 225 N 13 97981376 K595E T C missense Het probably benign 0.053 phenotype 05/09/2014
8 186693 UTSW Atp12a 0.000 R1660 G1 225 N 14 56370848 T98A A G missense Het probably benign 0.207 phenotype 05/09/2014
9 186675 UTSW Cdcp1 0.000 R1660 G1 225 N 9 123185362 S116T A T missense Het probably benign 0.090 phenotype 05/09/2014
10 186706 UTSW Chrm1 0.131 R1660 G1 153 N 19 8679218 F429S T C missense Het possibly damaging 0.533 phenotype 05/09/2014
11 186642 UTSW Ckap5 1.000 R1660 G1 225 N 2 91562958 Q395K C A missense Het possibly damaging 0.915 phenotype 05/09/2014
12 186660 UTSW Cntn4 0.366 R1660 G1 225 N 6 106679297 I853K T A missense Het probably benign 0.355 phenotype 05/09/2014
13 186662 UTSW Cyp2g1 0.000 R1660 G1 225 N 7 26809682 G A critical splice acceptor site Het probably null phenotype 05/09/2014
14 186701 UTSW Dhx57 0.247 R1660 G1 225 N 17 80245728 V1257I C T missense Het possibly damaging 0.831 05/09/2014
15 186637 UTSW Disp1 0.852 R1660 G1 225 N 1 183087742 V1038D A T missense Het probably damaging 1.000 phenotype 05/09/2014
16 186672 UTSW Dmxl2 1.000 R1660 G1 225 N 9 54451030 S462T A T missense Het possibly damaging 0.679 phenotype 05/09/2014
17 186670 UTSW Exoc3l 0.218 R1660 G1 225 N 8 105293060 A G critical splice donor site 2 bp Het probably null 05/09/2014
18 186702 UTSW Fam210a 0.798 R1660 G1 225 N 18 68276096 T48A T C missense Het probably benign 0.225 phenotype 05/09/2014
19 186641 UTSW Fbxw5 0.290 R1660 G1 219 N 2 25503274 G A critical splice donor site 1 bp Het probably null phenotype 05/09/2014
20 186659 UTSW Fkbp9 0.224 R1660 G1 225 N 6 56873449 C437R T C missense Het probably damaging 1.000 05/09/2014
21 186695 UTSW Gpc5 0.000 R1660 G1 225 N 14 115399279 K458R A G missense Het probably benign 0.121 phenotype 05/09/2014
22 186677 UTSW Grik2 0.000 R1660 G1 225 N 10 49244343 G56* C A nonsense Het probably null phenotype 05/09/2014
23 186645 UTSW Igsf10 0.251 R1660 G1 225 N 3 59331285 T492A T C missense Het probably damaging 1.000 05/09/2014
24 186681 UTSW Kif1c 0.000 R1660 G1 141 N 11 70728397 L953F C T missense Het probably damaging 0.993 0.068 phenotype 05/09/2014
25 186665 UTSW Lrrc51 R1660 G1 225 N 7 101913438 Y145C T C missense Het probably damaging 1.000 05/09/2014
26 186683 UTSW Lsmem1 0.075 R1660 G1 217 N 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 05/09/2014
27 186643 UTSW Mapkbp1 0.000 R1660 G1 225 N 2 120018548 I682F A T missense Het possibly damaging 0.828 05/09/2014
28 186647 UTSW Mttp 0.783 R1660 G1 225 N 3 138103193 V718D A T missense Het probably damaging 0.999 phenotype 05/09/2014
29 186682 UTSW Myt1l 0.000 R1660 G1 187 N 12 29895273 D1012E T A missense Het unknown phenotype 05/09/2014
30 186648 UTSW Nbn 1.000 R1660 G1 225 N 4 15971771 G301D G A missense Het probably benign 0.056 phenotype 05/09/2014
31 186635 UTSW Ncstn 1.000 R1660 G1 225 N 1 172066772 S677C T A missense Het possibly damaging 0.783 phenotype 05/09/2014
32 186658 UTSW Nod1 0.000 R1660 G1 225 N 6 54944233 C A unclassified Het probably null phenotype 05/09/2014
33 186634 UTSW Nos1ap 0.000 R1660 G1 225 N 1 170514637 V52A A G missense Het possibly damaging 0.890 05/09/2014
34 186707 UTSW Olfr1450 0.059 R1660 G1 225 N 19 12953691 I34N T A missense Het probably damaging 0.995 phenotype 05/09/2014
35 186699 UTSW Olfr191 0.094 R1660 G1 225 N 16 59086343 I47F T A missense Het probably benign 0.001 0.090 phenotype 05/09/2014
36 186666 UTSW Olfr568 0.160 R1660 G1 225 N 7 102877656 Y179D T G missense Het probably damaging 1.000 phenotype 05/09/2014
37 186667 UTSW Olfr619 0.053 R1660 G1 225 N 7 103603675 L7* T A nonsense Het probably null phenotype 05/09/2014
38 186650 UTSW Phf13 0.221 R1660 G1 225 N 4 151992505 I77V T C missense Het probably benign 0.000 phenotype 05/09/2014
39 186704 UTSW Pias2 0.000 R1660 G1 225 N 18 77120129 K230E A G missense Het probably damaging 0.999 phenotype 05/09/2014
40 186703 UTSW Poli 0.000 R1660 G1 225 N 18 70509464 L469P A G missense Het probably damaging 0.994 phenotype 05/09/2014
41 186669 UTSW Prag1 0.000 R1660 G1 225 N 8 36140023 T973S A T missense Het possibly damaging 0.733 phenotype 05/09/2014
42 186698 UTSW Prpf40b 0.309 R1660 G1 225 N 15 99305561 H101Q C A missense Het probably damaging 0.995 phenotype 05/09/2014
43 186674 UTSW Prss50 0.054 R1660 G1 225 N 9 110862489 V287A T C missense Het possibly damaging 0.612 05/09/2014
44 186684 UTSW Rbm25 1.000 R1660 G1 225 N 12 83668150 C T unclassified Het probably benign 05/09/2014
45 186705 UTSW Rcor2 0.769 R1660 G1 195 N 19 7268972 V4A T C missense Het probably damaging 0.988 phenotype 05/09/2014
46 186690 UTSW Rnf180 0.125 R1660 G1 225 N 13 105270991 T17A T C missense Het probably benign 0.037 phenotype 05/09/2014
47 186671 UTSW Robo3 1.000 R1660 G1 225 N 9 37429144 V179E A T missense Het probably damaging 1.000 phenotype 05/09/2014
48 186694 UTSW Sacs 0.000 R1660 G1 225 N 14 61209009 S2835T T A missense Het probably damaging 0.993 phenotype 05/09/2014
49 186632 UTSW Serpinb3c 0.069 R1660 G1 225 N 1 107271702 H363L T A missense Het probably damaging 0.999 05/09/2014
50 186668 UTSW Setd1a 1.000 R1660 G1 146 N 7 127796669 T C unclassified Het probably benign phenotype 05/09/2014
51 186696 UTSW Skp2 0.000 R1660 G1 225 N 15 9125114 V126G A C missense Het probably benign 0.030 phenotype 05/09/2014
52 186644 UTSW Snph 0.000 R1660 G1 225 N 2 151594478 Q108* G A nonsense Het probably null phenotype 05/09/2014
53 186664 UTSW Snrpa1 0.965 R1660 G1 225 N 7 66069498 V144E T A missense Het probably damaging 1.000 05/09/2014
54 186685 UTSW Tifab 0.055 R1660 G1 225 N 13 56176435 E65G T C missense Het probably damaging 0.978 phenotype 05/09/2014
55 186649 UTSW Tmem201 0.361 R1660 G1 225 N 4 149719575 Y468N A T missense Het probably damaging 1.000 05/09/2014
56 186656 UTSW Tpcn1 0.000 R1660 G1 225 N 5 120549515 N388S T C missense Het possibly damaging 0.819 phenotype 05/09/2014
57 186692 UTSW Tssk4 0.701 R1660 G1 225 N 14 55650572 Q75R A G missense Het probably null 0.905 phenotype 05/09/2014
58 186631 UTSW Tuba4a 0.401 R1660 G1 162 N 1 75215903 N356D T C missense Het probably benign 0.349 phenotype 05/09/2014
59 186653 UTSW Ugt2b5 0.064 R1660 G1 225 N 5 87139618 D230V T A missense Het probably benign 0.001 05/09/2014
60 186639 UTSW Ush2a 0.674 R1660 G1 225 N 1 188916064 V4622A T C missense Het probably benign 0.000 phenotype 05/09/2014
61 186655 UTSW Vmn2r11 0.068 R1660 G1 225 N 5 109053858 Y260S T G missense Het possibly damaging 0.790 05/09/2014
62 186691 UTSW Vmn2r89 0.137 R1660 G1 225 N 14 51456236 H348N C A missense Het possibly damaging 0.479 05/09/2014
63 186700 UTSW Vmn2r96 0.178 R1660 G1 225 N 17 18597726 M714L A T missense Het probably benign 0.002 05/09/2014
64 186679 UTSW Wdr92 0.244 R1660 G1 225 N 11 17227183 E180D A T missense Het probably benign 0.003 phenotype 05/09/2014
65 186636 UTSW Zbtb18 1.000 R1660 G1 225 N 1 177447763 S221P T C missense Het probably benign 0.054 phenotype 05/09/2014
66 186661 UTSW Zfp418 0.074 R1660 G1 225 N 7 7181790 T251A A G missense Het probably benign 0.036 05/09/2014
67 186680 UTSW Zmynd15 0.189 R1660 G1 225 N 11 70463502 Y267C A G missense Het probably damaging 1.000 phenotype 05/09/2014
[records 1 to 67 of 67]