Incidental Mutations

77 incidental mutations are currently displayed, and affect 77 genes.
13 are Possibly Damaging.
31 are Probably Damaging.
25 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 77 of 77] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 187351 UTSW Adra2c 0.377 R1668 G1 225 N 5 35280297 S138P T C missense Het probably damaging 1.000 phenotype 05/09/2014
2 187399 UTSW Appl1 0.255 R1668 G1 225 N 14 26923854 S666R A C missense Het probably damaging 0.998 phenotype 05/09/2014
3 187383 UTSW Arhgap45 0.000 R1668 G1 225 N 10 80028750 S879G A G missense Het possibly damaging 0.820 05/09/2014
4 187388 UTSW Calcoco2 0.000 R1668 G1 225 N 11 96102737 M140V T C missense Het probably benign 0.334 05/09/2014
5 187398 UTSW Cap2 0.110 R1668 G1 225 N 13 46615323 H147N C A missense Het probably damaging 0.980 phenotype 05/09/2014
6 187371 UTSW Chd9 0.000 R1668 G1 225 N 8 91041186 H2437L A T missense Het probably damaging 0.992 05/09/2014
7 187372 UTSW Col5a3 0.215 R1668 G1 225 N 9 20771096 I1684T A G missense Het unknown phenotype 05/09/2014
8 187370 UTSW Comp 0.207 R1668 G1 225 N 8 70378957 A T splice site 7 bp Het probably null phenotype 05/09/2014
9 187418 UTSW Cyp2c50 0.059 R1668 G1 225 N 19 40091055 M198L A T missense Het probably benign 0.000 05/09/2014
10 187395 UTSW Dnaaf2 1.000 R1668 G1 225 N 12 69196691 V532A A G missense Het probably benign 0.043 phenotype 05/09/2014
11 187355 UTSW Dnah10 0.000 R1668 G1 225 N 5 124765562 Q1358L A T missense Het probably benign 0.003 phenotype 05/09/2014
12 187405 UTSW Dopey2 0.000 R1668 G1 225 N 16 93765516 S832T T A missense Het probably damaging 1.000 05/09/2014
13 187409 UTSW Dus3l 0.337 R1668 G1 188 N 17 56766912 F162C T G missense Het possibly damaging 0.728 05/09/2014
14 187412 UTSW Epb41l4a 0.000 R1668 G1 225 N 18 33921909 L42P A G missense Het probably damaging 1.000 phenotype 05/09/2014
15 187329 UTSW Ercc5 1.000 R1668 G1 225 N 1 44167033 S369T T A missense Het probably benign 0.038 phenotype 05/09/2014
16 187345 UTSW Fam205a1 0.093 R1668 G1 124 N 4 42848424 T1244K G T missense Het probably damaging 0.993 05/09/2014
17 187379 UTSW Fbxl2 0.000 R1668 G1 225 N 9 113989146 V211M C T missense Het probably benign 0.004 phenotype 05/09/2014
18 187414 UTSW Fermt3 1.000 R1668 G1 225 N 19 7018692 V45A A G missense Het probably damaging 1.000 phenotype 05/09/2014
19 187408 UTSW Frs3 0.417 R1668 G1 125 N 17 47703222 P280Q C A missense Het possibly damaging 0.935 phenotype 05/09/2014
20 187416 UTSW Fxn 1.000 R1668 G1 225 N 19 24262013 Y172H A G missense Het probably damaging 1.000 phenotype 05/09/2014
21 187404 UTSW Gabpa 1.000 R1668 G1 225 N 16 84846181 V122A T C missense Het probably damaging 0.978 phenotype 05/09/2014
22 187376 UTSW Gsta4 0.000 R1668 G1 225 N 9 78204288 T66A A G missense Het probably benign 0.005 phenotype 05/09/2014
23 187346 UTSW Hsdl2 0.000 R1668 G1 225 N 4 59612697 T296M C T missense Het probably damaging 0.999 05/09/2014
24 187347 UTSW Kank4 0.108 R1668 G1 225 N 4 98778896 N438S T C missense Het probably damaging 0.978 05/09/2014
25 187389 UTSW Krt24 0.166 R1668 G1 225 N 11 99284618 I197T A G missense Het probably benign 0.163 phenotype 05/09/2014
26 187332 UTSW Lct 0.000 R1668 G1 225 N 1 128287722 T C splice site Het probably null phenotype 05/09/2014
27 187392 UTSW Lsmem1 0.070 R1668 G1 217 N 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 05/09/2014
28 187413 UTSW Mc4r 0.130 R1668 G1 225 N 18 66859409 L211P A G missense Het probably damaging 1.000 phenotype 05/09/2014
29 187382 UTSW Mfsd4b5 0.063 R1668 G1 225 N 10 39973691 T111A T C missense Het probably damaging 0.978 05/09/2014
30 187391 UTSW Mgat5b 0.104 R1668 G1 225 N 11 116983648 N635K T A missense Het probably benign 0.013 phenotype 05/09/2014
31 187419 UTSW Mms19 0.967 R1668 G1 225 N 19 41952556 M443K A T missense Het possibly damaging 0.730 05/09/2014
32 187385 UTSW Morc2a 1.000 R1668 G1 225 N 11 3675885 V162M G A missense Het probably benign 0.001 0.090 phenotype 05/09/2014
33 187401 UTSW Mroh5 0.054 R1668 G1 225 N 15 73787905 N359S T C missense Het probably benign 0.427 05/09/2014
34 187333 UTSW Mroh9 0.000 R1668 G1 225 N 1 163024592 I843V T C missense Het possibly damaging 0.524 05/09/2014
35 187377 UTSW Nbeal2 0.376 R1668 G1 194 N 9 110638893 D436G T C missense Het probably damaging 0.998 phenotype 05/09/2014
36 187390 UTSW Nbr1 0.000 R1668 G1 225 N 11 101569766 D502G A G missense Het probably benign 0.002 phenotype 05/09/2014
37 187387 UTSW Ngfr 0.775 R1668 G1 109 N 11 95587545 G5D C T missense Het probably damaging 0.999 phenotype 05/09/2014
38 187411 UTSW Nlrc4 0.156 R1668 G1 225 N 17 74445906 T494M G A missense Het probably damaging 0.969 phenotype 05/09/2014
39 187406 UTSW Notch3 0.000 R1668 G1 225 N 17 32158589 H171L T A missense Het probably damaging 0.994 phenotype 05/09/2014
40 187344 UTSW Nsmaf 0.119 R1668 G1 225 N 4 6398880 L795P A G missense Het probably damaging 0.984 phenotype 05/09/2014
41 187361 UTSW Nup210 0.000 R1668 G1 225 N 6 91028805 T616A T C missense Het possibly damaging 0.890 phenotype 05/09/2014
42 187415 UTSW Olfr1467 0.178 R1668 G1 225 N 19 13364870 M81L A C missense Het probably benign 0.001 phenotype 05/09/2014
43 187335 UTSW Olfr347 0.111 R1668 G1 225 N 2 36735192 Y290* T A nonsense Het probably null phenotype 05/09/2014
44 187374 UTSW Olfr975 0.058 R1668 G1 225 N 9 39950169 V201L C A missense Het possibly damaging 0.941 phenotype 05/09/2014
45 187338 UTSW Olfr995 0.123 R1668 G1 225 N 2 85438876 Y94F T A missense Het probably benign 0.001 phenotype 05/09/2014
46 187368 UTSW Osbpl5 0.000 R1668 G1 149 N 7 143709039 H192R T C missense Het probably damaging 0.995 phenotype 05/09/2014
47 187400 UTSW Parp2 0.405 R1668 G1 225 N 14 50820856 R486Q G A missense Het probably benign 0.001 phenotype 05/09/2014
48 187420 UTSW Pcgf6 0.525 R1668 G1 225 N 19 47040105 A286V G A missense Het probably damaging 1.000 phenotype 05/09/2014
49 187336 UTSW Pla2r1 0.000 R1668 G1 225 N 2 60428646 T1133A T C missense Het probably damaging 0.989 phenotype 05/09/2014
50 187369 UTSW Plekha2 0.000 R1668 G1 200 N 8 25072054 N48S T C missense Het probably damaging 0.984 phenotype 05/09/2014
51 187353 UTSW Pole 1.000 R1668 G1 225 N 5 110297369 S461A T G missense Het probably damaging 1.000 phenotype 05/09/2014
52 187367 UTSW Ppfibp2 0.000 R1668 G1 225 N 7 107729892 L536P T C missense Het probably damaging 1.000 phenotype 05/09/2014
53 187349 UTSW Prkcz 0.000 R1668 G1 225 N 4 155289751 F69L G T missense Het probably damaging 1.000 phenotype 05/09/2014
54 187393 UTSW Prkd1 1.000 R1668 G1 225 N 12 50394926 H277Y G A missense Het probably damaging 0.999 0.973 phenotype 05/09/2014
55 187328 UTSW Rab23 1.000 R1668 G1 225 N 1 33734854 K132* A T nonsense Het probably null phenotype 05/09/2014
56 187339 UTSW Rbck1 0.000 R1668 G1 122 N 2 152316899 S488C T A missense Het probably damaging 0.992 phenotype 05/09/2014
57 187340 UTSW Rbl1 0.000 R1668 G1 225 N 2 157159734 Y878C T C missense Het probably damaging 1.000 phenotype 05/09/2014
58 187341 UTSW Rpn2 1.000 R1668 G1 225 N 2 157294155 T161M C T missense Het possibly damaging 0.930 phenotype 05/09/2014
59 187330 UTSW Rufy4 0.353 R1668 G1 225 N 1 74147678 V542I G A missense Het probably benign 0.057 05/09/2014
60 187331 UTSW Serpinb3d 0.000 R1668 G1 225 N 1 107080751 V128A A G missense Het probably benign 0.182 05/09/2014
61 187417 UTSW Smarca2 0.000 R1668 G1 225 N 19 26647034 I365V A G missense Het possibly damaging 0.650 phenotype 05/09/2014
62 187396 UTSW Sptb 0.773 R1668 G1 225 N 12 76621169 V718A A G missense Het probably benign 0.000 phenotype 05/09/2014
63 187334 UTSW Susd4 0.304 R1668 G1 225 N 1 182858563 H226R A G missense Het probably benign 0.108 05/09/2014
64 187407 UTSW Tmem151b 0.000 R1668 G1 225 N 17 45545905 Y203C T C missense Het probably damaging 1.000 05/09/2014
65 187380 UTSW Tmppe 0.534 R1668 G1 225 N 9 114404900 V89A T C missense Het possibly damaging 0.887 phenotype 05/09/2014
66 187394 UTSW Trappc6b 0.227 R1668 G1 225 N 12 59048121 A T critical splice donor site 2 bp Het probably null phenotype 05/09/2014
67 187348 UTSW Ube4b 1.000 R1668 G1 225 N 4 149361294 M433K A T missense Het probably benign 0.020 phenotype 05/09/2014
68 187397 UTSW Vmn1r202 0.099 R1668 G1 225 N 13 22501370 D292E A T missense Het possibly damaging 0.945 05/09/2014
69 187357 UTSW Vmn1r22 0.143 R1668 G1 225 N 6 57900719 M91T A G missense Het probably benign 0.073 05/09/2014
70 187359 UTSW Vmn1r43 0.058 R1668 G1 225 N 6 89869701 I268V T C missense Het probably benign 0.007 05/09/2014
71 187360 UTSW Vmn1r49 0.100 R1668 G1 225 N 6 90072782 R79S T A missense Het probably benign 0.074 phenotype 05/09/2014
72 187352 UTSW Vmn2r14 0.155 R1668 G1 225 N 5 109219047 K436* T A nonsense Het probably null 05/09/2014
73 187375 UTSW Wdr72 0.207 R1668 G1 225 N 9 74210162 S719G A G missense Het probably damaging 0.988 phenotype 05/09/2014
74 187363 UTSW Zfp526 0.206 R1668 G1 225 N 7 25225542 F409L T C missense Het probably benign 0.147 05/09/2014
75 187350 UTSW Zfp804b 0.212 R1668 G1 225 N 5 6771323 L580R A C missense Het possibly damaging 0.925 05/09/2014
76 187364 UTSW Zfp977 0.137 R1668 G1 225 N 7 42580646 T152A T C missense Het probably benign 0.027 05/09/2014
77 187356 UTSW Zyx 0.000 R1668 G1 225 N 6 42356032 V372E T A missense Het possibly damaging 0.481 phenotype 05/09/2014
[records 1 to 77 of 77]