Incidental Mutations

77 incidental mutations are currently displayed, and affect 77 genes.
13 are Possibly Damaging.
31 are Probably Damaging.
25 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 77 of 77] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 187351 UTSW Adra2c 0.377 R1668 G1 225 N 5 35280297 S138P T C missense Het probably damaging 1.000 phenotype 05/09/2014
2 187399 UTSW Appl1 0.330 R1668 G1 225 N 14 26923854 S666R A C missense Het probably damaging 0.998 phenotype 05/09/2014
3 187383 UTSW Arhgap45 0.000 R1668 G1 225 N 10 80028750 S879G A G missense Het possibly damaging 0.820 05/09/2014
4 187388 UTSW Calcoco2 0.000 R1668 G1 225 N 11 96102737 M140V T C missense Het probably benign 0.334 05/09/2014
5 187398 UTSW Cap2 0.090 R1668 G1 225 N 13 46615323 H147N C A missense Het probably damaging 0.980 phenotype 05/09/2014
6 187371 UTSW Chd9 0.000 R1668 G1 225 N 8 91041186 H2437L A T missense Het probably damaging 0.992 05/09/2014
7 187372 UTSW Col5a3 0.478 R1668 G1 225 N 9 20771096 I1684T A G missense Het unknown phenotype 05/09/2014
8 187370 UTSW Comp 0.354 R1668 G1 225 N 8 70378957 A T splice site 7 bp Het probably null phenotype 05/09/2014
9 187418 UTSW Cyp2c50 0.104 R1668 G1 225 N 19 40091055 M198L A T missense Het probably benign 0.000 05/09/2014
10 187395 UTSW Dnaaf2 1.000 R1668 G1 225 N 12 69196691 V532A A G missense Het probably benign 0.043 phenotype 05/09/2014
11 187355 UTSW Dnah10 0.149 R1668 G1 225 N 5 124765562 Q1358L A T missense Het probably benign 0.003 phenotype 05/09/2014
12 187405 UTSW Dopey2 0.000 R1668 G1 225 N 16 93765516 S832T T A missense Het probably damaging 1.000 05/09/2014
13 187409 UTSW Dus3l 0.326 R1668 G1 188 N 17 56766912 F162C T G missense Het possibly damaging 0.728 05/09/2014
14 187412 UTSW Epb41l4a 0.000 R1668 G1 225 N 18 33921909 L42P A G missense Het probably damaging 1.000 phenotype 05/09/2014
15 187329 UTSW Ercc5 1.000 R1668 G1 225 N 1 44167033 S369T T A missense Het probably benign 0.038 phenotype 05/09/2014
16 187345 UTSW Fam205a1 0.078 R1668 G1 124 N 4 42848424 T1244K G T missense Het probably damaging 0.993 05/09/2014
17 187379 UTSW Fbxl2 0.000 R1668 G1 225 N 9 113989146 V211M C T missense Het probably benign 0.004 phenotype 05/09/2014
18 187414 UTSW Fermt3 1.000 R1668 G1 225 N 19 7018692 V45A A G missense Het probably damaging 1.000 phenotype 05/09/2014
19 187408 UTSW Frs3 0.810 R1668 G1 125 N 17 47703222 P280Q C A missense Het possibly damaging 0.935 phenotype 05/09/2014
20 187416 UTSW Fxn 1.000 R1668 G1 225 N 19 24262013 Y172H A G missense Het probably damaging 1.000 phenotype 05/09/2014
21 187404 UTSW Gabpa 1.000 R1668 G1 225 N 16 84846181 V122A T C missense Het probably damaging 0.978 phenotype 05/09/2014
22 187376 UTSW Gsta4 0.000 R1668 G1 225 N 9 78204288 T66A A G missense Het probably benign 0.005 phenotype 05/09/2014
23 187346 UTSW Hsdl2 0.000 R1668 G1 225 N 4 59612697 T296M C T missense Het probably damaging 0.999 05/09/2014
24 187347 UTSW Kank4 0.074 R1668 G1 225 N 4 98778896 N438S T C missense Het probably damaging 0.978 05/09/2014
25 187389 UTSW Krt24 0.119 R1668 G1 225 N 11 99284618 I197T A G missense Het probably benign 0.163 phenotype 05/09/2014
26 187332 UTSW Lct 0.000 R1668 G1 225 N 1 128287722 T C splice site Het probably null phenotype 05/09/2014
27 187392 UTSW Lsmem1 0.075 R1668 G1 217 N 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 05/09/2014
28 187413 UTSW Mc4r 0.067 R1668 G1 225 N 18 66859409 L211P A G missense Het probably damaging 1.000 phenotype 05/09/2014
29 187382 UTSW Mfsd4b5 0.074 R1668 G1 225 N 10 39973691 T111A T C missense Het probably damaging 0.978 05/09/2014
30 187391 UTSW Mgat5b 0.088 R1668 G1 225 N 11 116983648 N635K T A missense Het probably benign 0.013 phenotype 05/09/2014
31 187419 UTSW Mms19 0.964 R1668 G1 225 N 19 41952556 M443K A T missense Het possibly damaging 0.730 05/09/2014
32 187385 UTSW Morc2a 1.000 R1668 G1 225 N 11 3675885 V162M G A missense Het probably benign 0.001 0.090 phenotype 05/09/2014
33 187401 UTSW Mroh5 0.059 R1668 G1 225 N 15 73787905 N359S T C missense Het probably benign 0.427 05/09/2014
34 187333 UTSW Mroh9 0.000 R1668 G1 225 N 1 163024592 I843V T C missense Het possibly damaging 0.524 05/09/2014
35 187377 UTSW Nbeal2 0.462 R1668 G1 194 N 9 110638893 D436G T C missense Het probably damaging 0.998 phenotype 05/09/2014
36 187390 UTSW Nbr1 0.000 R1668 G1 225 N 11 101569766 D502G A G missense Het probably benign 0.002 phenotype 05/09/2014
37 187387 UTSW Ngfr 0.736 R1668 G1 109 N 11 95587545 G5D C T missense Het probably damaging 0.999 phenotype 05/09/2014
38 187411 UTSW Nlrc4 0.154 R1668 G1 225 N 17 74445906 T494M G A missense Het probably damaging 0.969 phenotype 05/09/2014
39 187406 UTSW Notch3 0.000 R1668 G1 225 N 17 32158589 H171L T A missense Het probably damaging 0.994 phenotype 05/09/2014
40 187344 UTSW Nsmaf 0.114 R1668 G1 225 N 4 6398880 L795P A G missense Het probably damaging 0.984 phenotype 05/09/2014
41 187361 UTSW Nup210 0.000 R1668 G1 225 N 6 91028805 T616A T C missense Het possibly damaging 0.890 phenotype 05/09/2014
42 187415 UTSW Olfr1467 0.096 R1668 G1 225 N 19 13364870 M81L A C missense Het probably benign 0.001 phenotype 05/09/2014
43 187335 UTSW Olfr347 0.164 R1668 G1 225 N 2 36735192 Y290* T A nonsense Het probably null phenotype 05/09/2014
44 187374 UTSW Olfr975 0.056 R1668 G1 225 N 9 39950169 V201L C A missense Het possibly damaging 0.941 phenotype 05/09/2014
45 187338 UTSW Olfr995 0.093 R1668 G1 225 N 2 85438876 Y94F T A missense Het probably benign 0.001 phenotype 05/09/2014
46 187368 UTSW Osbpl5 0.000 R1668 G1 149 N 7 143709039 H192R T C missense Het probably damaging 0.995 phenotype 05/09/2014
47 187400 UTSW Parp2 0.462 R1668 G1 225 N 14 50820856 R486Q G A missense Het probably benign 0.001 phenotype 05/09/2014
48 187420 UTSW Pcgf6 0.424 R1668 G1 225 N 19 47040105 A286V G A missense Het probably damaging 1.000 phenotype 05/09/2014
49 187336 UTSW Pla2r1 0.000 R1668 G1 225 N 2 60428646 T1133A T C missense Het probably damaging 0.989 phenotype 05/09/2014
50 187369 UTSW Plekha2 0.000 R1668 G1 200 N 8 25072054 N48S T C missense Het probably damaging 0.984 phenotype 05/09/2014
51 187353 UTSW Pole 1.000 R1668 G1 225 N 5 110297369 S461A T G missense Het probably damaging 1.000 phenotype 05/09/2014
52 187367 UTSW Ppfibp2 0.000 R1668 G1 225 N 7 107729892 L536P T C missense Het probably damaging 1.000 phenotype 05/09/2014
53 187349 UTSW Prkcz 0.000 R1668 G1 225 N 4 155289751 F69L G T missense Het probably damaging 1.000 phenotype 05/09/2014
54 187393 UTSW Prkd1 1.000 R1668 G1 225 N 12 50394926 H277Y G A missense Het probably damaging 0.999 0.973 phenotype 05/09/2014
55 187328 UTSW Rab23 1.000 R1668 G1 225 N 1 33734854 K132* A T nonsense Het probably null phenotype 05/09/2014
56 187339 UTSW Rbck1 0.000 R1668 G1 122 N 2 152316899 S488C T A missense Het probably damaging 0.992 phenotype 05/09/2014
57 187340 UTSW Rbl1 0.000 R1668 G1 225 N 2 157159734 Y878C T C missense Het probably damaging 1.000 phenotype 05/09/2014
58 187341 UTSW Rpn2 1.000 R1668 G1 225 N 2 157294155 T161M C T missense Het possibly damaging 0.930 phenotype 05/09/2014
59 187330 UTSW Rufy4 0.384 R1668 G1 225 N 1 74147678 V542I G A missense Het probably benign 0.057 05/09/2014
60 187331 UTSW Serpinb3d 0.000 R1668 G1 225 N 1 107080751 V128A A G missense Het probably benign 0.182 05/09/2014
61 187417 UTSW Smarca2 0.000 R1668 G1 225 N 19 26647034 I365V A G missense Het possibly damaging 0.650 phenotype 05/09/2014
62 187396 UTSW Sptb 0.802 R1668 G1 225 N 12 76621169 V718A A G missense Het probably benign 0.000 phenotype 05/09/2014
63 187334 UTSW Susd4 0.428 R1668 G1 225 N 1 182858563 H226R A G missense Het probably benign 0.108 05/09/2014
64 187407 UTSW Tmem151b 0.000 R1668 G1 225 N 17 45545905 Y203C T C missense Het probably damaging 1.000 05/09/2014
65 187380 UTSW Tmppe 0.459 R1668 G1 225 N 9 114404900 V89A T C missense Het possibly damaging 0.887 phenotype 05/09/2014
66 187394 UTSW Trappc6b 0.308 R1668 G1 225 N 12 59048121 A T critical splice donor site 2 bp Het probably null phenotype 05/09/2014
67 187348 UTSW Ube4b 1.000 R1668 G1 225 N 4 149361294 M433K A T missense Het probably benign 0.020 phenotype 05/09/2014
68 187397 UTSW Vmn1r202 0.085 R1668 G1 225 N 13 22501370 D292E A T missense Het possibly damaging 0.945 05/09/2014
69 187357 UTSW Vmn1r22 0.107 R1668 G1 225 N 6 57900719 M91T A G missense Het probably benign 0.073 05/09/2014
70 187359 UTSW Vmn1r43 0.055 R1668 G1 225 N 6 89869701 I268V T C missense Het probably benign 0.007 05/09/2014
71 187360 UTSW Vmn1r49 0.069 R1668 G1 225 N 6 90072782 R79S T A missense Het probably benign 0.074 phenotype 05/09/2014
72 187352 UTSW Vmn2r14 0.131 R1668 G1 225 N 5 109219047 K436* T A nonsense Het probably null 05/09/2014
73 187375 UTSW Wdr72 0.160 R1668 G1 225 N 9 74210162 S719G A G missense Het probably damaging 0.988 phenotype 05/09/2014
74 187363 UTSW Zfp526 0.242 R1668 G1 225 N 7 25225542 F409L T C missense Het probably benign 0.147 05/09/2014
75 187350 UTSW Zfp804b 0.223 R1668 G1 225 N 5 6771323 L580R A C missense Het possibly damaging 0.925 05/09/2014
76 187364 UTSW Zfp977 0.094 R1668 G1 225 N 7 42580646 T152A T C missense Het probably benign 0.027 05/09/2014
77 187356 UTSW Zyx 0.000 R1668 G1 225 N 6 42356032 V372E T A missense Het possibly damaging 0.481 phenotype 05/09/2014
[records 1 to 77 of 77]