Incidental Mutations

99 incidental mutations are currently displayed, and affect 99 genes.
14 are Possibly Damaging.
46 are Probably Damaging.
25 are Probably Benign.
13 are Probably Null.
3 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 99 of 99] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 192033 UTSW 4921513I03Rik R1694 G1 225 N 10 120778628 T C unclassified Het probably benign 05/14/2014
2 192049 UTSW 4930447C04Rik 0.175 R1694 G1 225 N 12 72885218 C T splice site 5 bp Het probably null phenotype 05/14/2014
3 192019 UTSW Abca16 0.000 R1694 G1 225 N 7 120520084 H1017R A G missense Het probably damaging 1.000 05/14/2014
4 192026 UTSW Actl11 0.090 R1694 G1 225 N 9 107930008 Y510C A G missense Het probably damaging 1.000 05/14/2014
5 191988 UTSW Agbl2 0.000 R1694 G1 225 N 2 90801320 T341A A G missense Het probably damaging 0.997 phenotype 05/14/2014
6 192001 UTSW Agbl5 0.000 R1694 G1 225 N 5 30893382 Y458C A G missense Het probably damaging 1.000 phenotype 05/14/2014
7 192050 UTSW Akap5 0.330 R1694 G1 225 N 12 76329924 S710L C T missense Het probably damaging 0.989 phenotype 05/14/2014
8 192056 UTSW Akr1c21 0.062 R1694 G1 225 N 13 4575178 E36G A G missense Het probably damaging 0.975 05/14/2014
9 192039 UTSW Arhgap44 0.000 R1694 G1 225 N 11 65053197 S163P A G missense Het probably damaging 1.000 05/14/2014
10 191991 UTSW Armc1 0.127 R1694 G1 225 N 3 19134886 V205A A G missense Het possibly damaging 0.815 05/14/2014
11 191993 UTSW Asph 0.000 R1694 G1 225 N 4 9610869 L102P A G missense Het probably damaging 0.989 phenotype 05/14/2014
12 192044 UTSW Brca1 1.000 R1694 G1 225 N 11 101532099 E74G T C missense Het probably damaging 0.976 phenotype 05/14/2014
13 192046 UTSW Brms1l 0.925 R1694 G1 225 N 12 55841600 R58G A G missense Het probably damaging 1.000 phenotype 05/14/2014
14 192042 UTSW C1qbp 1.000 R1694 G1 225 N 11 70978247 G T splice site Het probably null phenotype 05/14/2014
15 191987 UTSW Calcrl 1.000 R1694 G1 225 N 2 84339287 L350H A T missense Het probably damaging 1.000 phenotype 05/14/2014
16 192074 UTSW Casr 1.000 R1694 G1 225 N 16 36495591 F706I A T missense Het probably damaging 1.000 phenotype 05/14/2014
17 192013 UTSW Ceacam10 0.000 R1694 G1 225 N 7 24781066 N87K T A missense Het probably benign 0.271 phenotype 05/14/2014
18 191995 UTSW Cfap206 0.184 R1694 G1 225 N 4 34719058 T316K G T missense Het probably damaging 1.000 05/14/2014
19 191978 UTSW Col4a3 0.000 R1694 G1 225 N 1 82690663 A T splice site 3 bp Het probably null phenotype 05/14/2014
20 192060 UTSW Comtd1 0.219 R1694 G1 225 N 14 21847330 V183A A G missense Het probably damaging 1.000 05/14/2014
21 192071 UTSW Crygs 0.000 R1694 G1 225 N 16 22806675 A T splice site Het probably null phenotype 05/14/2014
22 192047 UTSW Dact1 1.000 R1694 G1 225 N 12 71312777 T139K C A missense Het probably damaging 0.997 phenotype 05/14/2014
23 192008 UTSW Dlx6 1.000 R1694 G1 225 N 6 6867173 W259R T C missense Het probably damaging 1.000 phenotype 05/14/2014
24 192040 UTSW Dnah9 0.465 R1694 G1 187 N 11 65954824 S627* G T nonsense Het probably null phenotype 05/14/2014
25 191999 UTSW Dnajc11 0.931 R1694 G1 225 N 4 151979273 V442D T A missense Het probably damaging 0.999 phenotype 05/14/2014
26 192064 UTSW Dnajc21 0.145 R1694 G1 225 N 15 10451563 S393T A T missense Het probably benign 0.001 phenotype 05/14/2014
27 192083 UTSW Dpysl3 0.306 R1694 G1 225 N 18 43328374 C584F C A missense Het possibly damaging 0.942 phenotype 05/14/2014
28 191997 UTSW Efcab14 0.000 R1694 G1 225 N 4 115746539 K138R A G missense Het possibly damaging 0.821 05/14/2014
29 192070 UTSW Ephb3 0.908 R1694 G1 225 N 16 21221745 E577G A G missense Het probably damaging 1.000 phenotype 05/14/2014
30 192058 UTSW Exoc3 0.968 R1694 G1 225 N 13 74190065 C T splice site 5 bp Het probably null phenotype 05/14/2014
31 191984 UTSW Fam171a1 0.103 R1694 G1 225 N 2 3225623 S473G A G missense Het probably benign 0.002 05/14/2014
32 192028 UTSW Fbxl2 0.000 R1694 G1 225 N 9 114003171 F58L A T missense Het probably damaging 0.988 phenotype 05/14/2014
33 191983 UTSW Fmo6 0.078 R1694 G1 225 N 1 162922672 M272V T C missense Het probably benign 0.000 05/14/2014
34 192055 UTSW Gm1000 R1694 G1 225 N 12 104476600 T C unclassified Het probably benign 05/14/2014
35 192011 UTSW Gm765 0.167 R1694 G1 225 N 6 98238139 S174R A C missense Het probably damaging 0.978 05/14/2014
36 192076 UTSW Grik1 0.000 R1694 G1 225 N 16 87950068 D442V T A missense Het probably damaging 0.959 phenotype 05/14/2014
37 192045 UTSW Hectd1 1.000 R1694 G1 181 N 12 51744592 Y2588H A G missense Het probably damaging 1.000 phenotype 05/14/2014
38 191992 UTSW Insrr 0.387 R1694 G1 225 N 3 87804062 T430P A C missense Het probably benign 0.000 phenotype 05/14/2014
39 192029 UTSW Lats1 0.837 R1694 G1 225 N 10 7701945 S278P T C missense Het probably benign 0.067 phenotype 05/14/2014
40 192006 UTSW Lrch4 0.211 R1694 G1 225 N 5 137638461 T463A A G missense Het probably benign 0.001 phenotype 05/14/2014
41 192081 UTSW Ltbp1 1.000 R1694 G1 225 N 17 75225285 Q118R A G missense Het possibly damaging 0.752 0.110 phenotype 05/14/2014
42 192057 UTSW Lyst 0.329 R1694 G1 225 N 13 13661161 F1809L T G missense Het probably damaging 0.978 phenotype 05/14/2014
43 192079 UTSW Mad2l1bp 0.909 R1694 G1 225 N 17 46152844 Y85H A G missense Het possibly damaging 0.496 phenotype 05/14/2014
44 191996 UTSW Magoh 1.000 R1694 G1 225 N 4 107883165 R82L G T missense Het probably benign 0.093 phenotype 05/14/2014
45 192027 UTSW Mlh1 0.000 R1694 G1 225 N 9 111228475 V756A A G missense Het probably damaging 1.000 phenotype 05/14/2014
46 192054 UTSW Mlh3 0.000 R1694 G1 225 N 12 85267141 E757G T C missense Het probably damaging 1.000 phenotype 05/14/2014
47 192063 UTSW Mycbp2 1.000 R1694 G1 225 N 14 103227511 T1339A T C missense Het probably damaging 0.995 phenotype 05/14/2014
48 191989 UTSW Myh7b 0.000 R1694 G1 225 N 2 155613193 E46V A T missense Het probably damaging 0.989 phenotype 05/14/2014
49 192023 UTSW Naalad2 0.413 R1694 G1 225 N 9 18327387 R677S T A missense Het probably damaging 0.959 phenotype 05/14/2014
50 192020 UTSW Nadsyn1 0.000 R1694 G1 225 N 7 143808012 T324I G A missense Het probably benign 0.001 phenotype 05/14/2014
51 192025 UTSW Neo1 1.000 R1694 G1 225 N 9 58880603 L1389Q A T missense Het probably damaging 1.000 phenotype 05/14/2014
52 192043 UTSW Nlrp1b 0.092 R1694 G1 225 N 11 71216855 A G critical splice donor site 2 bp Het probably null phenotype 05/14/2014
53 192010 UTSW Nup210 0.000 R1694 G1 225 N 6 91062803 I690S A C missense Het probably benign 0.095 phenotype 05/14/2014
54 192084 UTSW Olfr235 0.053 R1694 G1 187 N 19 12268917 I229N T A missense Het probably damaging 0.999 phenotype 05/14/2014
55 192018 UTSW Olfr543 0.092 R1694 G1 225 N 7 102477340 S177T A T missense Het probably benign 0.106 phenotype 05/14/2014
56 192034 UTSW Olfr824 0.116 R1694 G1 225 N 10 130126254 I268F T A missense Het possibly damaging 0.933 phenotype 05/14/2014
57 192016 UTSW Otud7a 0.141 R1694 G1 225 N 7 63733710 H316N C A missense Het probably damaging 1.000 phenotype 05/14/2014
58 192031 UTSW Pcdh15 0.000 R1694 G1 225 N 10 74594163 S1241P T C missense Het probably damaging 1.000 phenotype 05/14/2014
59 192000 UTSW Pclo 0.000 R1694 G1 225 N 5 14520963 K121E A G missense Het probably damaging 1.000 phenotype 05/14/2014
60 191974 UTSW Pcmtd1 0.087 R1694 G1 225 N 1 7147648 I107L A T missense Het probably benign 0.019 05/14/2014
61 192085 UTSW Pde6c 0.127 R1694 G1 225 N 19 38180225 I755V A G missense Het probably damaging 0.999 phenotype 05/14/2014
62 192035 UTSW Pes1 1.000 R1694 G1 144 N 11 3977719 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 05/14/2014
63 192068 UTSW Pi4ka 1.000 R1694 G1 225 N 16 17295376 I1532N A T missense Het probably damaging 0.985 phenotype 05/14/2014
64 191986 UTSW Pla2r1 0.000 R1694 G1 225 N 2 60441084 A G critical splice donor site 2 bp Het probably null phenotype 05/14/2014
65 192003 UTSW Plb1 0.070 R1694 G1 225 N 5 32317277 N661S A G missense Het probably null 0.007 phenotype 05/14/2014
66 192052 UTSW Plekhd1 0.072 R1694 G1 225 N 12 80722321 K452E A G missense Het possibly damaging 0.904 05/14/2014
67 192015 UTSW Prr12 0.333 R1694 G1 225 N 7 45028579 V2003F C A missense Het unknown phenotype 05/14/2014
68 192022 UTSW Ptger1 0.085 R1694 G1 225 N 8 83668478 G195R G A missense Het probably benign 0.009 phenotype 05/14/2014
69 191979 UTSW Ptpn4 0.302 R1694 G1 225 N 1 119783510 Q67R T C missense Het probably damaging 0.991 phenotype 05/14/2014
70 191981 UTSW Rgsl1 0.000 R1694 G1 188 N 1 153804676 R760H C T missense Het probably damaging 0.980 0.350 05/14/2014
71 192082 UTSW Rock1 0.945 R1694 G1 225 N 18 10136094 A G critical splice donor site 2 bp Het probably null phenotype 05/14/2014
72 192048 UTSW Rtn1 0.000 R1694 G1 187 N 12 72223524 Y71C T C missense Het probably damaging 1.000 phenotype 05/14/2014
73 192072 UTSW Rtp4 0.079 R1694 G1 225 N 16 23613120 *62Q T C makesense Het probably null 05/14/2014
74 192077 UTSW Scaf4 0.796 R1694 G1 102 N 16 90229857 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 05/14/2014
75 192041 UTSW Scimp 0.086 R1694 G1 225 N 11 70793792 P78H G T missense Het probably damaging 0.997 phenotype 05/14/2014
76 192067 UTSW Scn8a 0.872 R1694 G1 225 N 15 100955528 S132* C A nonsense Het probably null phenotype 05/14/2014
77 191985 UTSW Set 0.748 R1694 G1 225 N 2 30069424 I124M A G missense Het probably damaging 0.980 phenotype 05/14/2014
78 191975 UTSW Sf3b1 1.000 R1694 G1 225 N 1 55019395 E12Q C G missense Het possibly damaging 0.894 0.137 phenotype 05/14/2014
79 192007 UTSW Sgce 0.405 R1694 G1 225 N 6 4689709 S375P A G missense Het probably damaging 1.000 phenotype 05/14/2014
80 192002 UTSW Slc4a1ap 0.604 R1694 G1 225 N 5 31543754 E600Q G C missense Het probably damaging 0.996 05/14/2014
81 192086 UTSW Slit1 0.000 R1694 G1 221 N 19 41637592 V577A A G missense Het possibly damaging 0.690 phenotype 05/14/2014
82 192037 UTSW Sqstm1 0.000 R1694 G1 225 N 11 50207480 V153A A G missense Het probably benign 0.001 phenotype 05/14/2014
83 191990 UTSW Src 0.914 R1694 G1 225 N 2 157469755 M468V A G missense Het possibly damaging 0.951 phenotype 05/14/2014
84 192005 UTSW Srrm3 0.371 R1694 G1 134 N 5 135873225 A G unclassified Het probably benign 05/14/2014
85 191977 UTSW Stk11ip 1.000 R1694 G1 225 N 1 75527386 R257W C T missense Het probably damaging 0.999 05/14/2014
86 192073 UTSW Tfrc 1.000 R1694 G1 225 N 16 32614625 D32E T A missense Het probably damaging 0.991 phenotype 05/14/2014
87 191982 UTSW Tor1aip2 0.147 R1694 G1 225 N 1 156065285 I446L A T missense Het probably benign 0.000 05/14/2014
88 192030 UTSW Trmt11 0.793 R1694 G1 225 N 10 30535225 H424R T C missense Het probably benign 0.017 05/14/2014
89 192078 UTSW Urb1 1.000 R1694 G1 225 N 16 90767040 Y1612H A G missense Het probably benign 0.000 05/14/2014
90 192059 UTSW Vcan 1.000 R1694 G1 225 N 13 89688483 S2981T A T missense Het probably damaging 0.976 phenotype 05/14/2014
91 192038 UTSW Vdac1 0.630 R1694 G1 225 N 11 52374363 G21A G C missense Het probably damaging 0.958 phenotype 05/14/2014
92 192017 UTSW Vmn2r76 0.149 R1694 G1 225 N 7 86230148 S315P A G missense Het probably benign 0.065 05/14/2014
93 192036 UTSW Xpo1 1.000 R1694 G1 225 N 11 23281399 T328A A G missense Het probably benign 0.118 phenotype 05/14/2014
94 191976 UTSW Xrcc5 1.000 R1694 G1 225 N 1 72319096 L197F C T missense Het possibly damaging 0.883 phenotype 05/14/2014
95 192061 UTSW Zfhx2 0.352 R1694 G1 225 N 14 55073944 S431C G C missense Het possibly damaging 0.906 05/14/2014
96 192053 UTSW Zfp410 0.345 R1694 G1 225 N 12 84325720 P54S C T missense Het probably benign 0.000 05/14/2014
97 192024 UTSW Zfp560 0.000 R1694 G1 225 N 9 20347986 G527* C A nonsense Het probably null 05/14/2014
98 192009 UTSW Zfp775 0.165 R1694 G1 151 N 6 48619455 T88A A G missense Het possibly damaging 0.528 05/14/2014
99 192014 UTSW Zfp780b 0.070 R1694 G1 225 N 7 27964383 H249L T A missense Het possibly damaging 0.860 05/14/2014
[records 1 to 99 of 99]