Incidental Mutations

99 incidental mutations are currently displayed, and affect 99 genes.
14 are Possibly Damaging.
46 are Probably Damaging.
25 are Probably Benign.
13 are Probably Null.
3 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 99 of 99] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 192033 UTSW 4921513I03Rik R1694 G1 225 N 10 120778628 T C unclassified Het probably benign 05/14/2014
2 192049 UTSW 4930447C04Rik 0.162 R1694 G1 225 N 12 72885218 C T splice site 5 bp Het probably null phenotype 05/14/2014
3 192019 UTSW Abca16 0.000 R1694 G1 225 N 7 120520084 H1017R A G missense Het probably damaging 1.000 05/14/2014
4 192026 UTSW Actl11 0.069 R1694 G1 225 N 9 107930008 Y510C A G missense Het probably damaging 1.000 05/14/2014
5 191988 UTSW Agbl2 0.000 R1694 G1 225 N 2 90801320 T341A A G missense Het probably damaging 0.997 phenotype 05/14/2014
6 192001 UTSW Agbl5 0.000 R1694 G1 225 N 5 30893382 Y458C A G missense Het probably damaging 1.000 phenotype 05/14/2014
7 192050 UTSW Akap5 0.288 R1694 G1 225 N 12 76329924 S710L C T missense Het probably damaging 0.989 phenotype 05/14/2014
8 192056 UTSW Akr1c21 0.055 R1694 G1 225 N 13 4575178 E36G A G missense Het probably damaging 0.975 05/14/2014
9 192039 UTSW Arhgap44 0.000 R1694 G1 225 N 11 65053197 S163P A G missense Het probably damaging 1.000 05/14/2014
10 191991 UTSW Armc1 0.168 R1694 G1 225 N 3 19134886 V205A A G missense Het possibly damaging 0.815 05/14/2014
11 191993 UTSW Asph 0.000 R1694 G1 225 N 4 9610869 L102P A G missense Het probably damaging 0.989 phenotype 05/14/2014
12 192044 UTSW Brca1 1.000 R1694 G1 225 N 11 101532099 E74G T C missense Het probably damaging 0.976 phenotype 05/14/2014
13 192046 UTSW Brms1l 0.933 R1694 G1 225 N 12 55841600 R58G A G missense Het probably damaging 1.000 phenotype 05/14/2014
14 192042 UTSW C1qbp 1.000 R1694 G1 225 N 11 70978247 G T splice site Het probably null phenotype 05/14/2014
15 191987 UTSW Calcrl 1.000 R1694 G1 225 N 2 84339287 L350H A T missense Het probably damaging 1.000 phenotype 05/14/2014
16 192074 UTSW Casr 1.000 R1694 G1 225 N 16 36495591 F706I A T missense Het probably damaging 1.000 phenotype 05/14/2014
17 192013 UTSW Ceacam10 0.000 R1694 G1 225 N 7 24781066 N87K T A missense Het probably benign 0.271 phenotype 05/14/2014
18 191995 UTSW Cfap206 0.278 R1694 G1 225 N 4 34719058 T316K G T missense Het probably damaging 1.000 05/14/2014
19 191978 UTSW Col4a3 0.000 R1694 G1 225 N 1 82690663 A T splice site 3 bp Het probably null phenotype 05/14/2014
20 192060 UTSW Comtd1 0.134 R1694 G1 225 N 14 21847330 V183A A G missense Het probably damaging 1.000 05/14/2014
21 192071 UTSW Crygs 0.000 R1694 G1 225 N 16 22806675 A T splice site Het probably null phenotype 05/14/2014
22 192047 UTSW Dact1 1.000 R1694 G1 225 N 12 71312777 T139K C A missense Het probably damaging 0.997 phenotype 05/14/2014
23 192008 UTSW Dlx6 1.000 R1694 G1 225 N 6 6867173 W259R T C missense Het probably damaging 1.000 phenotype 05/14/2014
24 192040 UTSW Dnah9 0.322 R1694 G1 187 N 11 65954824 S627* G T nonsense Het probably null phenotype 05/14/2014
25 191999 UTSW Dnajc11 0.961 R1694 G1 225 N 4 151979273 V442D T A missense Het probably damaging 0.999 phenotype 05/14/2014
26 192064 UTSW Dnajc21 0.162 R1694 G1 225 N 15 10451563 S393T A T missense Het probably benign 0.001 phenotype 05/14/2014
27 192083 UTSW Dpysl3 0.302 R1694 G1 225 N 18 43328374 C584F C A missense Het possibly damaging 0.942 phenotype 05/14/2014
28 191997 UTSW Efcab14 0.000 R1694 G1 225 N 4 115746539 K138R A G missense Het possibly damaging 0.821 05/14/2014
29 192070 UTSW Ephb3 0.925 R1694 G1 225 N 16 21221745 E577G A G missense Het probably damaging 1.000 phenotype 05/14/2014
30 192058 UTSW Exoc3 0.967 R1694 G1 225 N 13 74190065 C T splice site 5 bp Het probably null phenotype 05/14/2014
31 191984 UTSW Fam171a1 0.171 R1694 G1 225 N 2 3225623 S473G A G missense Het probably benign 0.002 05/14/2014
32 192028 UTSW Fbxl2 0.000 R1694 G1 225 N 9 114003171 F58L A T missense Het probably damaging 0.988 phenotype 05/14/2014
33 191983 UTSW Fmo6 0.080 R1694 G1 225 N 1 162922672 M272V T C missense Het probably benign 0.000 05/14/2014
34 192055 UTSW Gm1000 R1694 G1 225 N 12 104476600 T C unclassified Het probably benign 05/14/2014
35 192011 UTSW Gm765 0.099 R1694 G1 225 N 6 98238139 S174R A C missense Het probably damaging 0.978 05/14/2014
36 192076 UTSW Grik1 0.000 R1694 G1 225 N 16 87950068 D442V T A missense Het probably damaging 0.959 phenotype 05/14/2014
37 192045 UTSW Hectd1 1.000 R1694 G1 181 N 12 51744592 Y2588H A G missense Het probably damaging 1.000 phenotype 05/14/2014
38 191992 UTSW Insrr 0.439 R1694 G1 225 N 3 87804062 T430P A C missense Het probably benign 0.000 phenotype 05/14/2014
39 192029 UTSW Lats1 0.842 R1694 G1 225 N 10 7701945 S278P T C missense Het probably benign 0.067 phenotype 05/14/2014
40 192006 UTSW Lrch4 0.233 R1694 G1 225 N 5 137638461 T463A A G missense Het probably benign 0.001 phenotype 05/14/2014
41 192081 UTSW Ltbp1 1.000 R1694 G1 225 N 17 75225285 Q118R A G missense Het possibly damaging 0.752 0.110 phenotype 05/14/2014
42 192057 UTSW Lyst 0.389 R1694 G1 225 N 13 13661161 F1809L T G missense Het probably damaging 0.978 phenotype 05/14/2014
43 192079 UTSW Mad2l1bp 0.908 R1694 G1 225 N 17 46152844 Y85H A G missense Het possibly damaging 0.496 phenotype 05/14/2014
44 191996 UTSW Magoh 1.000 R1694 G1 225 N 4 107883165 R82L G T missense Het probably benign 0.093 phenotype 05/14/2014
45 192027 UTSW Mlh1 0.000 R1694 G1 225 N 9 111228475 V756A A G missense Het probably damaging 1.000 phenotype 05/14/2014
46 192054 UTSW Mlh3 0.000 R1694 G1 225 N 12 85267141 E757G T C missense Het probably damaging 1.000 phenotype 05/14/2014
47 192063 UTSW Mycbp2 1.000 R1694 G1 225 N 14 103227511 T1339A T C missense Het probably damaging 0.995 phenotype 05/14/2014
48 191989 UTSW Myh7b 0.000 R1694 G1 225 N 2 155613193 E46V A T missense Het probably damaging 0.989 phenotype 05/14/2014
49 192023 UTSW Naalad2 0.435 R1694 G1 225 N 9 18327387 R677S T A missense Het probably damaging 0.959 phenotype 05/14/2014
50 192020 UTSW Nadsyn1 0.000 R1694 G1 225 N 7 143808012 T324I G A missense Het probably benign 0.001 phenotype 05/14/2014
51 192025 UTSW Neo1 1.000 R1694 G1 225 N 9 58880603 L1389Q A T missense Het probably damaging 1.000 phenotype 05/14/2014
52 192043 UTSW Nlrp1b 0.067 R1694 G1 225 N 11 71216855 A G critical splice donor site 2 bp Het probably null phenotype 05/14/2014
53 192010 UTSW Nup210 0.000 R1694 G1 225 N 6 91062803 I690S A C missense Het probably benign 0.095 phenotype 05/14/2014
54 192084 UTSW Olfr235 0.049 R1694 G1 187 N 19 12268917 I229N T A missense Het probably damaging 0.999 phenotype 05/14/2014
55 192018 UTSW Olfr543 0.075 R1694 G1 225 N 7 102477340 S177T A T missense Het probably benign 0.106 phenotype 05/14/2014
56 192034 UTSW Olfr824 0.107 R1694 G1 225 N 10 130126254 I268F T A missense Het possibly damaging 0.933 phenotype 05/14/2014
57 192016 UTSW Otud7a 0.195 R1694 G1 225 N 7 63733710 H316N C A missense Het probably damaging 1.000 phenotype 05/14/2014
58 192031 UTSW Pcdh15 0.000 R1694 G1 225 N 10 74594163 S1241P T C missense Het probably damaging 1.000 phenotype 05/14/2014
59 192000 UTSW Pclo 0.000 R1694 G1 225 N 5 14520963 K121E A G missense Het probably damaging 1.000 phenotype 05/14/2014
60 191974 UTSW Pcmtd1 0.082 R1694 G1 225 N 1 7147648 I107L A T missense Het probably benign 0.019 05/14/2014
61 192085 UTSW Pde6c 0.112 R1694 G1 225 N 19 38180225 I755V A G missense Het probably damaging 0.999 phenotype 05/14/2014
62 192035 UTSW Pes1 1.000 R1694 G1 144 N 11 3977719 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 05/14/2014
63 192068 UTSW Pi4ka 1.000 R1694 G1 225 N 16 17295376 I1532N A T missense Het probably damaging 0.985 phenotype 05/14/2014
64 191986 UTSW Pla2r1 0.000 R1694 G1 225 N 2 60441084 A G critical splice donor site 2 bp Het probably null phenotype 05/14/2014
65 192003 UTSW Plb1 0.054 R1694 G1 225 N 5 32317277 N661S A G missense Het probably null 0.007 phenotype 05/14/2014
66 192052 UTSW Plekhd1 0.058 R1694 G1 225 N 12 80722321 K452E A G missense Het possibly damaging 0.904 05/14/2014
67 192015 UTSW Prr12 0.427 R1694 G1 225 N 7 45028579 V2003F C A missense Het unknown phenotype 05/14/2014
68 192022 UTSW Ptger1 0.069 R1694 G1 225 N 8 83668478 G195R G A missense Het probably benign 0.009 phenotype 05/14/2014
69 191979 UTSW Ptpn4 0.343 R1694 G1 225 N 1 119783510 Q67R T C missense Het probably damaging 0.991 phenotype 05/14/2014
70 191981 UTSW Rgsl1 0.000 R1694 G1 188 N 1 153804676 R760H C T missense Het probably damaging 0.980 0.350 05/14/2014
71 192082 UTSW Rock1 0.948 R1694 G1 225 N 18 10136094 A G critical splice donor site 2 bp Het probably null phenotype 05/14/2014
72 192048 UTSW Rtn1 0.000 R1694 G1 187 N 12 72223524 Y71C T C missense Het probably damaging 1.000 phenotype 05/14/2014
73 192072 UTSW Rtp4 0.085 R1694 G1 225 N 16 23613120 *62Q T C makesense Het probably null 05/14/2014
74 192077 UTSW Scaf4 0.710 R1694 G1 102 N 16 90229857 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 05/14/2014
75 192041 UTSW Scimp 0.065 R1694 G1 225 N 11 70793792 P78H G T missense Het probably damaging 0.997 phenotype 05/14/2014
76 192067 UTSW Scn8a 0.841 R1694 G1 225 N 15 100955528 S132* C A nonsense Het probably null phenotype 05/14/2014
77 191985 UTSW Set 0.686 R1694 G1 225 N 2 30069424 I124M A G missense Het probably damaging 0.980 phenotype 05/14/2014
78 191975 UTSW Sf3b1 1.000 R1694 G1 225 N 1 55019395 E12Q C G missense Het possibly damaging 0.894 0.137 phenotype 05/14/2014
79 192007 UTSW Sgce 0.383 R1694 G1 225 N 6 4689709 S375P A G missense Het probably damaging 1.000 phenotype 05/14/2014
80 192002 UTSW Slc4a1ap 0.671 R1694 G1 225 N 5 31543754 E600Q G C missense Het probably damaging 0.996 05/14/2014
81 192086 UTSW Slit1 0.000 R1694 G1 221 N 19 41637592 V577A A G missense Het possibly damaging 0.690 phenotype 05/14/2014
82 192037 UTSW Sqstm1 0.000 R1694 G1 225 N 11 50207480 V153A A G missense Het probably benign 0.001 phenotype 05/14/2014
83 191990 UTSW Src 0.895 R1694 G1 225 N 2 157469755 M468V A G missense Het possibly damaging 0.951 phenotype 05/14/2014
84 192005 UTSW Srrm3 0.357 R1694 G1 134 N 5 135873225 A G unclassified Het probably benign 05/14/2014
85 191977 UTSW Stk11ip 1.000 R1694 G1 225 N 1 75527386 R257W C T missense Het probably damaging 0.999 05/14/2014
86 192073 UTSW Tfrc 1.000 R1694 G1 225 N 16 32614625 D32E T A missense Het probably damaging 0.991 phenotype 05/14/2014
87 191982 UTSW Tor1aip2 0.144 R1694 G1 225 N 1 156065285 I446L A T missense Het probably benign 0.000 05/14/2014
88 192030 UTSW Trmt11 0.877 R1694 G1 225 N 10 30535225 H424R T C missense Het probably benign 0.017 05/14/2014
89 192078 UTSW Urb1 1.000 R1694 G1 225 N 16 90767040 Y1612H A G missense Het probably benign 0.000 05/14/2014
90 192059 UTSW Vcan 1.000 R1694 G1 225 N 13 89688483 S2981T A T missense Het probably damaging 0.976 phenotype 05/14/2014
91 192038 UTSW Vdac1 0.796 R1694 G1 225 N 11 52374363 G21A G C missense Het probably damaging 0.958 phenotype 05/14/2014
92 192017 UTSW Vmn2r76 0.122 R1694 G1 225 N 7 86230148 S315P A G missense Het probably benign 0.065 05/14/2014
93 192036 UTSW Xpo1 1.000 R1694 G1 225 N 11 23281399 T328A A G missense Het probably benign 0.118 phenotype 05/14/2014
94 191976 UTSW Xrcc5 1.000 R1694 G1 225 N 1 72319096 L197F C T missense Het possibly damaging 0.883 phenotype 05/14/2014
95 192061 UTSW Zfhx2 0.244 R1694 G1 225 N 14 55073944 S431C G C missense Het possibly damaging 0.906 05/14/2014
96 192053 UTSW Zfp410 0.186 R1694 G1 225 N 12 84325720 P54S C T missense Het probably benign 0.000 05/14/2014
97 192024 UTSW Zfp560 0.000 R1694 G1 225 N 9 20347986 G527* C A nonsense Het probably null 05/14/2014
98 192009 UTSW Zfp775 0.108 R1694 G1 151 N 6 48619455 T88A A G missense Het possibly damaging 0.528 05/14/2014
99 192014 UTSW Zfp780b 0.064 R1694 G1 225 N 7 27964383 H249L T A missense Het possibly damaging 0.860 05/14/2014
[records 1 to 99 of 99]