Incidental Mutations

58 incidental mutations are currently displayed, and affect 58 genes.
11 are Possibly Damaging.
21 are Probably Damaging.
17 are Probably Benign.
8 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 58 of 58] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 190952 UTSW 1700023F06Rik 0.049 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
2 190923 UTSW 2210010C04Rik 0.087 R1715 G1 225 N 6 41032936 A G splice site 6 bp Het probably null 05/14/2014
3 190963 UTSW 2410089E03Rik 1.000 R1715 G1 225 N 15 8226900 T A splice site Het probably null phenotype 05/14/2014
4 190953 UTSW Abca8a 0.063 R1715 G1 225 N 11 110091580 T12M G A missense Het probably damaging 0.983 05/14/2014
5 190924 UTSW Alms1 0.000 R1715 G1 225 N 6 85629052 Y2561* T A nonsense Het probably null phenotype 05/14/2014
6 190929 UTSW Atp10a 0.092 R1715 G1 225 N 7 58786505 V348I G A missense Het probably damaging 0.980 p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 05/14/2014
7 190934 UTSW Best2 0.111 R1715 G1 225 N 8 85011223 Y181C T C missense Het probably benign 0.413 phenotype 05/14/2014
8 190970 UTSW Btaf1 0.969 R1715 G1 225 N 19 36969121 D442E T A missense Het probably damaging 0.991 phenotype 05/14/2014
9 190967 UTSW C330027C09Rik 0.966 R1715 G1 225 N 16 49005719 T383I C T missense Het probably benign 0.184 phenotype 05/14/2014
10 190962 UTSW Carmil3 0.303 R1715 G1 225 N 14 55504532 V1153G T G missense Het probably benign 0.021 05/14/2014
11 190920 UTSW Cc2d2a 0.913 R1715 G1 225 N 5 43718661 I993M A G missense Het probably damaging 0.971 phenotype 05/14/2014
12 190948 UTSW Ccng1 0.270 R1715 G1 225 N 11 40752114 P169S G A missense Het probably benign 0.020 0.059 phenotype 05/14/2014
13 190937 UTSW Cmtr2 1.000 R1715 G1 225 N 8 110222798 L580P T C missense Het probably damaging 1.000 05/14/2014
14 190964 UTSW Col22a1 0.000 R1715 G1 225 N 15 72006981 E109G T C missense Het possibly damaging 0.790 phenotype 05/14/2014
15 190939 UTSW Crispld2 1.000 R1715 G1 225 N 8 120023649 W264L G T missense Het possibly damaging 0.748 phenotype 05/14/2014
16 190971 UTSW Cyp2c38 0.094 R1715 G1 225 N 19 39404795 H276R T C missense Het probably benign 0.248 05/14/2014
17 190945 UTSW Dag1 0.922 R1715 G1 225 N 9 108208715 V409E A T missense Het possibly damaging 0.921 phenotype 05/14/2014
18 190940 UTSW Emc8 1.000 R1715 G1 148 N 8 120658555 N146S T C missense Het probably benign 0.076 05/14/2014
19 190959 UTSW Glt8d1 0.000 R1715 G1 225 N 14 31011521 V321A T C missense Het possibly damaging 0.949 phenotype 05/14/2014
20 190947 UTSW Gm5174 0.134 R1715 G1 225 N 10 86656912 C T unclassified Het noncoding transcript 05/14/2014
21 190965 UTSW Hdac10 0.000 R1715 G1 225 N 15 89126709 G T splice site Het probably null phenotype 05/14/2014
22 190922 UTSW Hectd4 0.927 R1715 G1 225 N 5 121344818 D3144G A G missense Het possibly damaging 0.845 05/14/2014
23 190917 UTSW Ifna11 0.058 R1715 G1 225 N 4 88820236 S93L C T missense Het probably damaging 1.000 05/14/2014
24 190931 UTSW Il16 0.234 R1715 G1 225 N 7 83648728 N431S T C missense Het probably benign 0.011 phenotype 05/14/2014
25 190941 UTSW Irf8 0.000 R1715 G1 157 N 8 120754388 E237V A T missense Het probably damaging 0.978 phenotype 05/14/2014
26 190912 UTSW Lrp1b 0.000 R1715 G1 225 N 2 41185981 Y1769H A G missense Het probably damaging 0.999 phenotype 05/14/2014
27 190956 UTSW Lrrc9 0.167 R1715 G1 225 N 12 72477299 N761D A G missense Het probably damaging 1.000 05/14/2014
28 190938 UTSW Mbtps1 1.000 R1715 G1 121 N 8 119542730 Y207C T C missense Het probably benign 0.400 phenotype 05/14/2014
29 190943 UTSW Myo9a 0.000 R1715 G1 225 N 9 59832300 E765G A G missense Het probably damaging 0.990 phenotype 05/14/2014
30 190949 UTSW Nlrp3 0.072 R1715 G1 222 N 11 59543351 D80G A G missense Het probably damaging 1.000 phenotype 05/14/2014
31 190911 UTSW Olfr361 0.069 R1715 G1 225 N 2 37085176 P191S G A missense Het probably damaging 0.995 phenotype 05/14/2014
32 190932 UTSW Olfr697 0.088 R1715 G1 225 N 7 106741548 P129A G C missense Het probably damaging 1.000 phenotype 05/14/2014
33 190942 UTSW Olfr830 0.120 R1715 G1 225 N 9 18875794 I156F A T missense Het probably benign 0.059 phenotype 05/14/2014
34 190954 UTSW Pcyt2 1.000 R1715 G1 157 N 11 120615851 T A splice site 2569 bp Het probably null phenotype 05/14/2014
35 190925 UTSW Plxnd1 1.000 R1715 G1 202 N 6 115968681 T944A T C missense Het probably benign 0.021 phenotype 05/14/2014
36 190909 UTSW Psd4 0.000 R1715 G1 225 N 2 24405332 I833F A T missense Het probably damaging 1.000 05/14/2014
37 190936 UTSW Psmd7 1.000 R1715 G1 225 N 8 107581185 I222T A G missense Het probably benign 0.048 phenotype 05/14/2014
38 190914 UTSW Rap2b R1715 G1 225 N 3 61365190 E45G A G missense Het probably damaging 0.983 phenotype 05/14/2014
39 190969 UTSW Rbm22 1.000 R1715 G1 225 N 18 60560844 S7P T C missense Het possibly damaging 0.653 phenotype 05/14/2014
40 190944 UTSW Rbpms2 0.000 R1715 G1 217 N 9 65651666 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC unclassified Het probably benign 0.090 phenotype 05/14/2014
41 190946 UTSW Rfx4 1.000 R1715 G1 225 N 10 84844280 N107S A G missense Het probably damaging 0.995 phenotype 05/14/2014
42 190916 UTSW Ripk2 0.196 R1715 G1 225 N 4 16155192 T A critical splice acceptor site Het probably null phenotype 05/14/2014
43 190961 UTSW Rpgrip1 0.203 R1715 G1 225 N 14 52140691 C499S T A missense Het possibly damaging 0.533 phenotype 05/14/2014
44 190951 UTSW Scarf1 0.000 R1715 G1 171 N 11 75524044 S515P T C missense Het probably damaging 1.000 phenotype 05/14/2014
45 190918 UTSW Sgip1 0.000 R1715 G1 225 N 4 102915059 V215A T C missense Het probably benign 0.087 phenotype 05/14/2014
46 190915 UTSW Sis 0.000 R1715 G1 225 N 3 72889010 I1813V T C missense Het possibly damaging 0.466 phenotype 05/14/2014
47 190958 UTSW Slc17a3 0.000 R1715 G1 225 N 13 23856741 T317S A T missense Het probably benign 0.185 phenotype 05/14/2014
48 190933 UTSW Slc35e1 0.179 R1715 G1 225 N 8 72483977 N340S T C missense Het probably benign 0.049 05/14/2014
49 190950 UTSW Smg6 1.000 R1715 G1 225 N 11 74929430 I176V A G missense Het probably benign 0.000 phenotype 05/14/2014
50 190926 UTSW Smim17 0.193 R1715 G1 225 N 7 6429326 L89S T C missense Het probably damaging 0.993 05/14/2014
51 190930 UTSW Synm 0.000 R1715 G1 225 N 7 67736303 N95S T C missense Het probably damaging 1.000 phenotype 05/14/2014
52 190957 UTSW Tdrd9 0.237 R1715 G1 225 N 12 112036439 K841E A G missense Het possibly damaging 0.615 phenotype 05/14/2014
53 190960 UTSW Tep1 0.000 R1715 G1 225 N 14 50854567 F570L G T missense Het possibly damaging 0.922 phenotype 05/14/2014
54 190913 UTSW Tgm3 0.000 R1715 G1 225 N 2 130026814 G A critical splice donor site 1 bp Het probably null phenotype 05/14/2014
55 190966 UTSW Tra2b 1.000 R1715 G1 225 N 16 22252746 Y128C T C missense Het possibly damaging 0.685 phenotype 05/14/2014
56 190921 UTSW Vmn2r17 0.086 R1715 G1 225 N 5 109428244 V327A T C missense Het probably benign 0.001 05/14/2014
57 190955 UTSW Wdr20rt 0.466 R1715 G1 225 N 12 65227314 D344V A T missense Het probably damaging 0.980 05/14/2014
58 190927 UTSW Zfp940 0.000 R1715 G1 225 N 7 29844938 C515R A G missense Het probably damaging 0.962 05/14/2014
[records 1 to 58 of 58]