Incidental Mutations

71 incidental mutations are currently displayed, and affect 71 genes.
13 are Possibly Damaging.
26 are Probably Damaging.
21 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 71 of 71] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 203351 UTSW 1700056E22Rik 0.066 R1804 G1 225 Y 1 184033203 Y220H A G missense Het probably benign 0.023 0.090 06/23/2014
2 203399 UTSW 2610507B11Rik 0.962 R1804 G1 225 Y 11 78273469 H1165R A G missense Het probably damaging 0.998 0.206 06/23/2014
3 203393 UTSW 4930579C12Rik 0.106 R1804 G1 141 Y 9 89152060 T C splice site Het noncoding transcript 0.087 06/23/2014
4 203381 UTSW Abcc8 0.552 R1804 G1 197 Y 7 46120479 S871G T C missense Het probably benign 0.020 0.191 phenotype 06/23/2014
5 203400 UTSW Acly 1.000 R1804 G1 184 Y 11 100515905 Y288C T C missense Het probably damaging 1.000 0.949 phenotype 06/23/2014
6 203412 UTSW Adgrb1 0.000 R1804 G1 225 Y 15 74529540 D128E T A missense Het probably damaging 1.000 0.647 phenotype 06/23/2014
7 203394 UTSW AF529169 0.000 R1804 G1 225 Y 9 89603099 M82L T A missense Het possibly damaging 0.909 0.070 06/23/2014
8 203376 UTSW Alms1 0.000 R1804 G1 225 Y 6 85621275 Q1497* C T nonsense Het probably null 0.971 phenotype 06/23/2014
9 203377 UTSW Cacna1c 0.350 R1804 G1 225 Y 6 118687046 T688M G A missense Het probably damaging 1.000 0.647 phenotype 06/23/2014
10 203389 UTSW Ccdc7a 0.055 R1804 G1 225 Y 8 128988766 L279* A T nonsense Het probably null 0.976 06/23/2014
11 203370 UTSW Cep135 1.000 R1804 G1 225 Y 5 76636932 E958G A G missense Het probably benign 0.222 0.076 phenotype 06/23/2014
12 203378 UTSW Clec4n 0.000 R1804 G1 225 Y 6 123230022 V2L G T missense Het possibly damaging 0.455 0.179 phenotype 06/23/2014
13 203372 UTSW Col28a1 0.080 R1804 G1 225 Y 6 8164612 C T critical splice donor site 1 bp Het probably null 0.949 phenotype 06/23/2014
14 203402 UTSW Dcaf5 0.309 R1804 G1 225 Y 12 80339829 S508P A G missense Het probably benign 0.190 0.161 06/23/2014
15 203388 UTSW Dlgap2 0.000 R1804 G1 225 Y 8 14727809 N351K C A missense Het possibly damaging 0.708 0.143 phenotype 06/23/2014
16 203414 UTSW Dnah8 0.308 R1804 G1 225 Y 17 30708407 Y1346N T A missense Het probably benign 0.002 0.084 phenotype 06/23/2014
17 203375 UTSW Dqx1 0.061 R1804 G1 225 Y 6 83060322 V322A T C missense Het probably damaging 0.999 0.221 06/23/2014
18 203385 UTSW Ebf3 1.000 R1804 G1 215 Y 7 137200521 L412V A C missense Het possibly damaging 0.887 0.179 phenotype 06/23/2014
19 203371 UTSW Epha5 0.000 R1804 G1 225 Y 5 84331815 N110S T C missense Het probably benign 0.209 0.063 phenotype 06/23/2014
20 203380 UTSW Fcgbp 0.000 R1804 G1 132 Y 7 28086139 C334R T C missense Het probably benign 0.000 0.090 06/23/2014
21 203415 UTSW Glp1r 0.000 R1804 G1 225 Y 17 30930713 T A splice site Het probably null 0.976 phenotype 06/23/2014
22 203425 UTSW Gm4952 0.070 R1804 G1 225 Y 19 12618420 R58L G T missense Het probably damaging 0.983 0.647 06/23/2014
23 203387 UTSW Gm7579 0.540 R1804 G1 127 Y 7 142211938 C27Y G A missense Het unknown 06/23/2014
24 203404 UTSW Golm1 0.074 R1804 G1 225 Y 13 59642389 T A critical splice acceptor site Het probably null 0.124 phenotype 06/23/2014
25 203426 UTSW Gucy2g 0.000 R1804 G1 225 Y 19 55210309 I801F T A missense Het probably benign 0.345 0.090 phenotype 06/23/2014
26 203416 UTSW H2-D1 0.137 R1804 G1 225 Y 17 35263552 Y83H T C missense Het probably damaging 1.000 0.522 phenotype 06/23/2014
27 203406 UTSW Homez 0.000 R1804 G1 225 Y 14 54857141 I19N A T missense Het probably damaging 0.999 0.898 06/23/2014
28 203374 UTSW Hoxa5 0.642 R1804 G1 225 Y 6 52202648 K249R T C missense Het probably damaging 1.000 0.406 phenotype 06/23/2014
29 203422 UTSW Hsd17b4 0.566 R1804 G1 225 Y 18 50177984 N550Y A T missense Het probably damaging 0.999 0.499 phenotype 06/23/2014
30 203407 UTSW Ipo4 0.151 R1804 G1 225 Y 14 55629456 N668K A T missense Het probably damaging 1.000 0.214 06/23/2014
31 203418 UTSW Kcnh8 0.000 R1804 G1 142 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 06/23/2014
32 203369 UTSW Klb 0.897 R1804 G1 225 Y 5 65379853 D842G A G missense Het probably damaging 1.000 0.420 phenotype 06/23/2014
33 203384 UTSW Mmp21 0.077 R1804 G1 213 Y 7 133678882 P120T G T missense Het probably benign 0.010 0.087 phenotype 06/23/2014
34 203363 UTSW Mroh7 0.000 R1804 G1 222 Y 4 106694392 I918F T A missense Het possibly damaging 0.763 0.203 06/23/2014
35 203386 UTSW Muc5b 0.160 R1804 G1 225 Y 7 141863780 T3488A A G missense Het possibly damaging 0.678 0.112 phenotype 06/23/2014
36 203420 UTSW Npc1 0.583 R1804 G1 225 Y 18 12223088 C42Y C T missense Het probably damaging 0.998 0.941 phenotype 06/23/2014
37 203398 UTSW Ogdh 1.000 R1804 G1 225 Y 11 6338565 Y214C A G missense Het probably damaging 1.000 0.974 phenotype 06/23/2014
38 203356 UTSW Olfr1042 0.070 R1804 G1 225 Y 2 86160073 T99N G T missense Het probably benign 0.380 0.090 phenotype 06/23/2014
39 203357 UTSW Olfr1277 0.069 R1804 G1 225 Y 2 111269930 M146V T C missense Het probably benign 0.000 0.090 phenotype 06/23/2014
40 203373 UTSW Olfr450 0.121 R1804 G1 225 Y 6 42818221 C250Y G A missense Het possibly damaging 0.657 0.179 phenotype 06/23/2014
41 203405 UTSW Olfr726 0.078 R1804 G1 225 Y 14 50083902 W260R A T missense Het probably damaging 0.992 0.647 phenotype 06/23/2014
42 203390 UTSW Olfr930 0.148 R1804 G1 225 Y 9 38930650 T160A A G missense Het possibly damaging 0.893 0.293 phenotype 06/23/2014
43 203360 UTSW Phtf1 0.000 R1804 G1 225 Y 3 103987567 A G unclassified Het probably benign 06/23/2014
44 203368 UTSW Plb1 0.063 R1804 G1 225 Y 5 32353697 N1302S A G missense Het possibly damaging 0.910 0.407 phenotype 06/23/2014
45 203349 UTSW Prex2 0.303 R1804 G1 225 Y 1 11132342 K492E A G missense Het probably damaging 0.999 0.642 phenotype 06/23/2014
46 203409 UTSW Prkaa1 0.000 R1804 G1 225 Y 15 5178778 D509G A G missense Het probably benign 0.406 0.074 phenotype 06/23/2014
47 203411 UTSW Rims2 0.473 R1804 G1 225 Y 15 39437043 Q57* C T nonsense Het probably null 0.976 phenotype 06/23/2014
48 203383 UTSW Rnf40 0.963 R1804 G1 225 Y 7 127595948 V411A T C missense Het possibly damaging 0.588 0.060 phenotype 06/23/2014
49 203362 UTSW Rraga 1.000 R1804 G1 225 Y 4 86576444 I176V A G missense Het probably damaging 0.994 0.527 phenotype 06/23/2014
50 203401 UTSW Rrm2 1.000 R1804 G1 225 Y 12 24708612 I51T T C missense Het probably benign 0.421 0.080 phenotype 06/23/2014
51 203403 UTSW Serpina3a 0.055 R1804 G1 225 Y 12 104118416 T A splice site Het probably benign 06/23/2014
52 203364 UTSW Skint7 0.059 R1804 G1 225 Y 4 111982012 W168R T C missense Het probably damaging 1.000 0.647 06/23/2014
53 203355 UTSW Slc27a4 1.000 R1804 G1 225 Y 2 29811267 M357V A G missense Het probably benign 0.012 0.178 phenotype 06/23/2014
54 203350 UTSW Slc4a3 0.112 R1804 G1 206 Y 1 75551717 H452R A G missense Het probably damaging 1.000 0.104 phenotype 06/23/2014
55 203413 UTSW Smc1b 0.627 R1804 G1 225 Y 15 85127790 I127K A T missense Het possibly damaging 0.896 0.155 phenotype 06/23/2014
56 203392 UTSW Snap91 0.882 R1804 G1 225 Y 9 86783417 M383L T A missense Het probably benign 0.010 0.064 phenotype 06/23/2014
57 203424 UTSW Taf6l 0.959 R1804 G1 225 Y 19 8773634 L52Q A T missense Het probably damaging 0.993 0.127 phenotype 06/23/2014
58 203366 UTSW Tas1r3 0.112 R1804 G1 225 Y 4 155860470 R765C G A missense Het probably damaging 0.988 0.484 phenotype 06/23/2014
59 203379 UTSW Tas2r124 0.071 R1804 G1 225 Y 6 132755525 I266V A G missense Het probably benign 0.107 0.090 06/23/2014
60 203365 UTSW Tesk2 0.169 R1804 G1 224 Y 4 116800621 T C unclassified Het probably benign 0.090 phenotype 06/23/2014
61 203359 UTSW Tmem131l 0.180 R1804 G1 225 Y 3 83910479 Q1237P T G missense Het possibly damaging 0.720 0.179 06/23/2014
62 203361 UTSW Tmem67 1.000 R1804 G1 225 Y 4 12045789 A G splice site 6 bp Het probably null 0.976 phenotype 06/23/2014
63 203421 UTSW Tnfaip8 0.256 R1804 G1 225 Y 18 50090661 C179S T A missense Het probably damaging 0.999 0.153 phenotype 06/23/2014
64 203353 UTSW Ush2a 0.483 R1804 G1 225 Y 1 188633729 G A critical splice donor site 1 bp Het probably null 0.949 phenotype 06/23/2014
65 203410 UTSW Vps13b 0.000 R1804 G1 114 Y 15 35917137 E3709V A T missense Het probably damaging 1.000 0.240 phenotype 06/23/2014
66 203423 UTSW Wdr7 0.954 R1804 G1 225 Y 18 63865440 S1153C A T missense Het probably damaging 0.998 0.141 phenotype 06/23/2014
67 203397 UTSW Zc2hc1b 0.224 R1804 G1 225 Y 10 13171268 A C splice site Het probably benign 06/23/2014
68 203419 UTSW Zfp438 0.143 R1804 G1 225 Y 18 5213689 I423T A G missense Het probably damaging 1.000 0.296 06/23/2014
69 203382 UTSW Zfp592 0.920 R1804 G1 225 Y 7 81023695 P136T C A missense Het probably damaging 1.000 0.076 phenotype 06/23/2014
70 271593 UTSW Zfp783 0.180 R1804 G1 225 Y 6 47945885 T A intron Het noncoding transcript 0.750 03/23/2015
71 203367 UTSW Zfp804b 0.193 R1804 G1 225 Y 5 6771756 S400T A T missense Het possibly damaging 0.780 0.116 06/23/2014
[records 1 to 71 of 71]