Incidental Mutations

80 incidental mutations are currently displayed, and affect 80 genes.
11 are Possibly Damaging.
26 are Probably Damaging.
32 are Probably Benign.
7 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 80 of 80] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 204929 UTSW 1700003H04Rik 0.057 R1833 G1 225 Y 3 124556860 D143V T A missense Het unknown 0.087 06/23/2014
2 204973 UTSW 4930438A08Rik 0.089 R1833 G1 225 Y 11 58288388 Q183* C T nonsense Het probably null 0.976 06/23/2014
3 204972 UTSW 9230009I02Rik 0.223 R1833 G1 225 Y 11 51091466 A G exon Het noncoding transcript 0.087 06/23/2014
4 204923 UTSW Abhd12 0.142 R1833 G1 225 Y 2 150848418 D119V T A missense Het probably damaging 0.968 0.179 phenotype 06/23/2014
5 204939 UTSW Adam1b 0.000 R1833 G1 225 Y 5 121502937 I15T A G missense Het possibly damaging 0.670 0.179 phenotype 06/23/2014
6 204985 UTSW Agtpbp1 0.797 R1833 G1 225 Y 13 59465983 A T critical splice donor site 2 bp Het probably null 0.959 phenotype 06/23/2014
7 204909 UTSW Arfgef1 1.000 R1833 G1 225 Y 1 10204890 I312M G C missense Het probably benign 0.008 0.090 phenotype 06/23/2014
8 204979 UTSW Arid4a 0.000 R1833 G1 225 Y 12 71075466 L874F C T missense Het possibly damaging 0.499 0.179 phenotype 06/23/2014
9 204977 UTSW Bcas3 0.675 R1833 G1 225 Y 11 85583949 V317I G A missense Het probably benign 0.003 0.060 06/23/2014
10 204970 UTSW Ccr1 0.098 R1833 G1 225 Y 9 123964089 I135F T A missense Het probably damaging 0.998 0.855 phenotype 06/23/2014
11 204961 UTSW Ces2h 0.068 R1833 G1 225 Y 8 105020373 E547G A G missense Het possibly damaging 0.927 0.112 phenotype 06/23/2014
12 204962 UTSW Ces3b 0.059 R1833 G1 225 Y 8 105085639 D173E T A missense Het probably damaging 0.983 0.442 06/23/2014
13 204974 UTSW Chd3 0.000 R1833 G1 225 Y 11 69354123 L1197S A G missense Het probably damaging 0.995 0.647 phenotype 06/23/2014
14 204960 UTSW Cngb1 1.000 R1833 G1 225 Y 8 95242355 L1175P A G missense Het probably damaging 0.998 0.163 phenotype 06/23/2014
15 204992 UTSW Cyp4f17 0.084 R1833 G1 225 Y 17 32524210 F286L T C missense Het probably benign 0.012 0.090 06/23/2014
16 205000 UTSW Dclre1a 0.000 R1833 G1 193 Y 19 56541500 C T splice site 5 bp Het probably null 0.976 phenotype 06/23/2014
17 204987 UTSW Dennd6a 0.212 R1833 G1 225 Y 14 26606954 L44H T A missense Het probably damaging 0.999 0.647 06/23/2014
18 204994 UTSW Dhx16 1.000 R1833 G1 225 Y 17 35885619 T560A A G missense Het probably benign 0.361 0.064 phenotype 06/23/2014
19 204916 UTSW Dusp12 1.000 R1833 G1 225 Y 1 170874453 M326V T C missense Het probably benign 0.000 0.059 phenotype 06/23/2014
20 204954 UTSW Eif3k 0.903 R1833 G1 225 Y 7 28971427 I180V T C missense Het probably benign 0.028 0.060 phenotype 06/23/2014
21 204946 UTSW Erc1 1.000 R1833 G1 225 Y 6 119743429 I437T A G missense Het possibly damaging 0.815 0.225 phenotype 06/23/2014
22 204980 UTSW Fam71d 0.060 R1833 G1 225 Y 12 78715506 G A unclassified Het probably benign 0.090 06/23/2014
23 204913 UTSW Farp2 0.000 R1833 G1 225 Y 1 93576364 T A splice site Het probably benign 0.090 phenotype 06/23/2014
24 204952 UTSW Foxa3 0.000 R1833 G1 225 Y 7 19014574 L209P A G missense Het probably damaging 0.999 0.930 phenotype 06/23/2014
25 204978 UTSW Gen1 0.227 R1833 G1 225 Y 12 11248351 A T splice site Het probably benign 0.090 phenotype 06/23/2014
26 204933 UTSW Gm10305 0.184 R1833 G1 205 Y 4 99273126 T91A A G missense Het unknown 0.087 06/23/2014
27 204982 UTSW Gm10436 0.151 R1833 G1 225 Y 12 88178448 E44G T C missense Het possibly damaging 0.727 0.179 06/23/2014
28 204925 UTSW Gm14412 0.719 R1833 G1 99 Y 2 177315790 D104G T C missense Het probably benign 0.002 0.090 06/23/2014
29 204999 UTSW Gm340 0.155 R1833 G1 225 Y 19 41584948 I714T T C missense Het probably benign 0.001 0.090 06/23/2014
30 204950 UTSW Gm6900 0.394 R1833 G1 225 Y 7 10656588 T C exon Het noncoding transcript 06/23/2014
31 204968 UTSW Gpx1 0.000 R1833 G1 126 Y 9 108339356 Y15F A T missense Het possibly damaging 0.888 0.219 phenotype 06/23/2014
32 204995 UTSW H2-M10.3 0.054 R1833 G1 225 Y 17 36367495 Y146C T C missense Het probably damaging 1.000 0.753 06/23/2014
33 204993 UTSW H2-Q7 0.302 R1833 G1 120 Y 17 35439699 S104R C A missense Het probably benign 0.005 0.090 phenotype 06/23/2014
34 204964 UTSW Hephl1 0.099 R1833 G1 225 Y 9 15076928 Y628C T C missense Het probably damaging 0.994 0.608 06/23/2014
35 204918 UTSW Hspa5 1.000 R1833 G1 225 Y 2 34776053 Y636* T A nonsense Het probably null 0.976 phenotype 06/23/2014
36 204936 UTSW Htt 1.000 R1833 G1 183 Y 5 34905748 A G splice site Het probably benign 0.090 phenotype 06/23/2014
37 204912 UTSW Idh1 0.000 R1833 G1 225 Y 1 65161114 I364V T C missense Het probably benign 0.000 0.059 phenotype 06/23/2014
38 204975 UTSW Itgae 0.000 R1833 G1 225 Y 11 73117162 A423S G T missense Het possibly damaging 0.944 0.289 phenotype 06/23/2014
39 204990 UTSW Kng2 0.000 R1833 G1 225 Y 16 23012052 N169S T C missense Het possibly damaging 0.948 0.199 06/23/2014
40 204983 UTSW Larp4b 0.658 R1833 G1 225 Y 13 9151199 T369I C T missense Het possibly damaging 0.895 0.179 phenotype 06/23/2014
41 204910 UTSW Lonrf2 0.099 R1833 G1 225 Y 1 38813276 P165S G A missense Het probably benign 0.140 0.079 06/23/2014
42 204935 UTSW Magi2 1.000 R1833 G1 225 Y 5 19227457 G57C G T missense Het probably damaging 1.000 0.402 phenotype 06/23/2014
43 204932 UTSW Mdn1 1.000 R1833 G1 225 Y 4 32720761 H2291Q T A missense Het probably damaging 0.968 0.118 06/23/2014
44 204943 UTSW Mgam 0.085 R1833 G1 225 Y 6 40654718 T C critical splice donor site 2 bp Het probably null 0.948 phenotype 06/23/2014
45 204940 UTSW Micall2 0.267 R1833 G1 225 Y 5 139716753 V245A A G missense Het probably benign 0.087 0.090 06/23/2014
46 204988 UTSW Mipep 0.956 R1833 G1 225 Y 14 60872063 Y630D T G missense Het probably damaging 1.000 0.885 phenotype 06/23/2014
47 204984 UTSW Msx2 0.000 R1833 G1 225 Y 13 53468185 M263K A T missense Het probably damaging 0.987 0.576 phenotype 06/23/2014
48 204953 UTSW Nectin2 0.185 R1833 G1 225 Y 7 19717708 P467H G T missense Het probably damaging 0.960 0.647 phenotype 06/23/2014
49 204986 UTSW Nek10 0.000 R1833 G1 225 Y 14 14842789 M165L A T missense Het probably benign 0.000 0.114 06/23/2014
50 204951 UTSW Nlrp4b 0.076 R1833 G1 225 Y 7 10725936 M455L A T missense Het probably benign 0.001 0.090 06/23/2014
51 204927 UTSW Oaz3 0.260 R1833 G1 192 Y 3 94436042 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG unclassified Het probably benign phenotype 06/23/2014
52 204921 UTSW Olfr1258 0.061 R1833 G1 225 Y 2 89930301 L164* T A nonsense Het probably null 0.976 phenotype 06/23/2014
53 204989 UTSW Olfr286 0.077 R1833 G1 225 Y 15 98226965 I227F T A missense Het probably damaging 0.998 0.812 phenotype 06/23/2014
54 204997 UTSW Pcx 1.000 R1833 G1 225 Y 19 4619104 V710E T A missense Het probably damaging 0.982 0.909 phenotype 06/23/2014
55 204930 UTSW Pkn2 1.000 R1833 G1 225 Y 3 142821647 R347Q C T missense Het probably damaging 1.000 0.132 phenotype 06/23/2014
56 204914 UTSW Qsox1 0.591 R1833 G1 225 Y 1 155791045 G233S C T missense Het probably benign 0.147 0.109 phenotype 06/23/2014
57 204924 UTSW Rbl1 0.000 R1833 G1 225 Y 2 157195555 N224I T A missense Het probably damaging 0.976 0.919 phenotype 06/23/2014
58 204959 UTSW Rspry1 0.438 R1833 G1 225 Y 8 94635488 T132A A G missense Het probably damaging 1.000 0.647 phenotype 06/23/2014
59 204926 UTSW Sclt1 0.305 R1833 G1 225 Y 3 41727111 V91A A G missense Het probably damaging 0.992 0.228 phenotype 06/23/2014
60 204945 UTSW Sema4f 0.000 R1833 G1 225 Y 6 82918559 L331H A T missense Het probably benign 0.017 0.090 phenotype 06/23/2014
61 204963 UTSW Sf3b3 0.966 R1833 G1 225 Y 8 110817566 Q814L T A missense Het probably benign 0.000 0.062 phenotype 06/23/2014
62 204915 UTSW Slc19a2 0.158 R1833 G1 225 Y 1 164262184 Y190D T G missense Het probably damaging 1.000 0.964 phenotype 06/23/2014
63 204969 UTSW Smarcc1 1.000 R1833 G1 225 Y 9 110153811 H204Q T A missense Het possibly damaging 0.711 0.179 phenotype 06/23/2014
64 204957 UTSW Sox6 1.000 R1833 G1 225 Y 7 115777093 K135E T C missense Het probably damaging 1.000 0.180 phenotype 06/23/2014
65 204941 UTSW Tecpr1 0.000 R1833 G1 159 Y 5 144208608 Q607R T C missense Het probably damaging 0.989 0.256 phenotype 06/23/2014
66 204958 UTSW Tgfb1i1 0.292 R1833 G1 207 Y 7 128249498 A G splice site Het probably benign phenotype 06/23/2014
67 204965 UTSW Tirap 0.220 R1833 G1 225 Y 9 35188703 R228S T G missense Het probably benign 0.185 0.090 phenotype 06/23/2014
68 204938 UTSW Tmem211 0.000 R1833 G1 172 Y 5 113234569 A G splice site Het probably benign 06/23/2014
69 204917 UTSW Trp53bp2 1.000 R1833 G1 225 Y 1 182429016 H50Q T A missense Het probably damaging 0.983 0.203 phenotype 06/23/2014
70 204944 UTSW Try4 0.000 R1833 G1 225 Y 6 41303431 H63R A G missense Het probably damaging 0.982 0.922 06/23/2014
71 204947 UTSW Vmn2r25 0.102 R1833 G1 225 Y 6 123839684 P313S G A missense Het probably benign 0.015 0.090 06/23/2014
72 204971 UTSW Vps26a 0.367 R1833 G1 225 Y 10 62459046 L250V A C missense Het probably benign 0.003 0.090 phenotype 06/23/2014
73 204948 UTSW Vwf 0.160 R1833 G1 225 Y 6 125642037 H1226R A G missense Het probably benign 0.142 0.124 phenotype 06/23/2014
74 204934 UTSW Wdtc1 0.000 R1833 G1 195 Y 4 133308742 TCC TC splice site Het probably benign 0.090 phenotype 06/23/2014
75 204942 UTSW Zc3hav1l 0.000 R1833 G1 225 Y 6 38297946 A T splice site Het probably benign 0.090 06/23/2014
76 204996 UTSW Zfp119b 0.059 R1833 G1 225 Y 17 55939271 H305P T G missense Het probably damaging 1.000 0.647 06/23/2014
77 204937 UTSW Zfp326 0.336 R1833 G1 225 Y 5 105891169 Q134* C T nonsense Het probably null 0.971 06/23/2014
78 204956 UTSW Zfp975 0.068 R1833 G1 225 Y 7 42661839 R450Q C T missense Het probably benign 0.006 0.119 06/23/2014
79 204981 UTSW Zfyve26 0.000 R1833 G1 120 Y 12 79286258 M313K A T missense Het probably benign 0.358 0.090 phenotype 06/23/2014
80 204949 UTSW Zscan5b 0.000 R1833 G1 225 Y 7 6238966 S395P T C missense Het possibly damaging 0.669 0.179 06/23/2014
[records 1 to 80 of 80]