Incidental Mutations

80 incidental mutations are currently displayed, and affect 80 genes.
11 are Possibly Damaging.
26 are Probably Damaging.
32 are Probably Benign.
7 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 80 of 80] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 204929 UTSW 1700003H04Rik 0.051 R1833 G1 225 Y 3 124556860 D143V T A missense Het unknown 0.087 06/23/2014
2 204973 UTSW 4930438A08Rik 0.079 R1833 G1 225 Y 11 58288388 Q183* C T nonsense Het probably null 0.976 06/23/2014
3 204972 UTSW 9230009I02Rik 0.208 R1833 G1 225 Y 11 51091466 A G exon Het noncoding transcript 0.087 06/23/2014
4 204923 UTSW Abhd12 0.191 R1833 G1 225 Y 2 150848418 D119V T A missense Het probably damaging 0.968 0.179 phenotype 06/23/2014
5 204939 UTSW Adam1b 0.000 R1833 G1 225 Y 5 121502937 I15T A G missense Het possibly damaging 0.670 0.179 phenotype 06/23/2014
6 204985 UTSW Agtpbp1 0.834 R1833 G1 225 Y 13 59465983 A T critical splice donor site 2 bp Het probably null 0.959 phenotype 06/23/2014
7 204909 UTSW Arfgef1 1.000 R1833 G1 225 Y 1 10204890 I312M G C missense Het probably benign 0.008 0.090 phenotype 06/23/2014
8 204979 UTSW Arid4a 0.000 R1833 G1 225 Y 12 71075466 L874F C T missense Het possibly damaging 0.499 0.179 phenotype 06/23/2014
9 204977 UTSW Bcas3 0.723 R1833 G1 225 Y 11 85583949 V317I G A missense Het probably benign 0.003 0.060 06/23/2014
10 204970 UTSW Ccr1 0.120 R1833 G1 225 Y 9 123964089 I135F T A missense Het probably damaging 0.998 0.855 phenotype 06/23/2014
11 204961 UTSW Ces2h 0.071 R1833 G1 225 Y 8 105020373 E547G A G missense Het possibly damaging 0.927 0.112 phenotype 06/23/2014
12 204962 UTSW Ces3b 0.055 R1833 G1 225 Y 8 105085639 D173E T A missense Het probably damaging 0.983 0.442 06/23/2014
13 204974 UTSW Chd3 0.000 R1833 G1 225 Y 11 69354123 L1197S A G missense Het probably damaging 0.995 0.647 phenotype 06/23/2014
14 204960 UTSW Cngb1 1.000 R1833 G1 225 Y 8 95242355 L1175P A G missense Het probably damaging 0.998 0.163 phenotype 06/23/2014
15 204992 UTSW Cyp4f17 0.064 R1833 G1 225 Y 17 32524210 F286L T C missense Het probably benign 0.012 0.090 06/23/2014
16 205000 UTSW Dclre1a 0.000 R1833 G1 193 Y 19 56541500 C T splice site 5 bp Het probably null 0.976 phenotype 06/23/2014
17 204987 UTSW Dennd6a 0.216 R1833 G1 225 Y 14 26606954 L44H T A missense Het probably damaging 0.999 0.647 06/23/2014
18 204994 UTSW Dhx16 1.000 R1833 G1 225 Y 17 35885619 T560A A G missense Het probably benign 0.361 0.064 phenotype 06/23/2014
19 204916 UTSW Dusp12 1.000 R1833 G1 225 Y 1 170874453 M326V T C missense Het probably benign 0.000 0.059 phenotype 06/23/2014
20 204954 UTSW Eif3k 0.940 R1833 G1 225 Y 7 28971427 I180V T C missense Het probably benign 0.028 0.060 phenotype 06/23/2014
21 204946 UTSW Erc1 1.000 R1833 G1 225 Y 6 119743429 I437T A G missense Het possibly damaging 0.815 0.225 phenotype 06/23/2014
22 204980 UTSW Fam71d 0.058 R1833 G1 225 Y 12 78715506 G A unclassified Het probably benign 0.090 06/23/2014
23 204913 UTSW Farp2 0.000 R1833 G1 225 Y 1 93576364 T A splice site Het probably benign 0.090 phenotype 06/23/2014
24 204952 UTSW Foxa3 0.000 R1833 G1 225 Y 7 19014574 L209P A G missense Het probably damaging 0.999 0.930 phenotype 06/23/2014
25 204978 UTSW Gen1 0.126 R1833 G1 225 Y 12 11248351 A T splice site Het probably benign 0.090 phenotype 06/23/2014
26 204933 UTSW Gm10305 0.124 R1833 G1 205 Y 4 99273126 T91A A G missense Het unknown 0.087 06/23/2014
27 204982 UTSW Gm10436 0.133 R1833 G1 225 Y 12 88178448 E44G T C missense Het possibly damaging 0.727 0.179 06/23/2014
28 204925 UTSW Gm14412 0.706 R1833 G1 99 Y 2 177315790 D104G T C missense Het probably benign 0.002 0.090 06/23/2014
29 204999 UTSW Gm340 0.086 R1833 G1 225 Y 19 41584948 I714T T C missense Het probably benign 0.001 0.090 06/23/2014
30 204950 UTSW Gm6900 0.394 R1833 G1 225 Y 7 10656588 T C exon Het noncoding transcript 06/23/2014
31 204968 UTSW Gpx1 0.000 R1833 G1 126 Y 9 108339356 Y15F A T missense Het possibly damaging 0.888 0.219 phenotype 06/23/2014
32 204995 UTSW H2-M10.3 0.052 R1833 G1 225 Y 17 36367495 Y146C T C missense Het probably damaging 1.000 0.753 06/23/2014
33 204993 UTSW H2-Q7 0.360 R1833 G1 120 Y 17 35439699 S104R C A missense Het probably benign 0.005 0.090 phenotype 06/23/2014
34 204964 UTSW Hephl1 0.102 R1833 G1 225 Y 9 15076928 Y628C T C missense Het probably damaging 0.994 0.608 06/23/2014
35 204918 UTSW Hspa5 1.000 R1833 G1 225 Y 2 34776053 Y636* T A nonsense Het probably null 0.976 phenotype 06/23/2014
36 204936 UTSW Htt 1.000 R1833 G1 183 Y 5 34905748 A G splice site Het probably benign 0.090 phenotype 06/23/2014
37 204912 UTSW Idh1 0.000 R1833 G1 225 Y 1 65161114 I364V T C missense Het probably benign 0.000 0.059 phenotype 06/23/2014
38 204975 UTSW Itgae 0.000 R1833 G1 225 Y 11 73117162 A423S G T missense Het possibly damaging 0.944 0.289 phenotype 06/23/2014
39 204990 UTSW Kng2 0.000 R1833 G1 225 Y 16 23012052 N169S T C missense Het possibly damaging 0.948 0.199 06/23/2014
40 204983 UTSW Larp4b 0.870 R1833 G1 225 Y 13 9151199 T369I C T missense Het possibly damaging 0.895 0.179 phenotype 06/23/2014
41 204910 UTSW Lonrf2 0.097 R1833 G1 225 Y 1 38813276 P165S G A missense Het probably benign 0.140 0.079 06/23/2014
42 204935 UTSW Magi2 1.000 R1833 G1 225 Y 5 19227457 G57C G T missense Het probably damaging 1.000 0.402 phenotype 06/23/2014
43 204932 UTSW Mdn1 1.000 R1833 G1 225 Y 4 32720761 H2291Q T A missense Het probably damaging 0.968 0.118 06/23/2014
44 204943 UTSW Mgam 0.095 R1833 G1 225 Y 6 40654718 T C critical splice donor site 2 bp Het probably null 0.948 phenotype 06/23/2014
45 204940 UTSW Micall2 0.177 R1833 G1 225 Y 5 139716753 V245A A G missense Het probably benign 0.087 0.090 06/23/2014
46 204988 UTSW Mipep 0.961 R1833 G1 225 Y 14 60872063 Y630D T G missense Het probably damaging 1.000 0.885 phenotype 06/23/2014
47 204984 UTSW Msx2 0.000 R1833 G1 225 Y 13 53468185 M263K A T missense Het probably damaging 0.987 0.576 phenotype 06/23/2014
48 204953 UTSW Nectin2 0.219 R1833 G1 225 Y 7 19717708 P467H G T missense Het probably damaging 0.960 0.647 phenotype 06/23/2014
49 204986 UTSW Nek10 0.000 R1833 G1 225 Y 14 14842789 M165L A T missense Het probably benign 0.000 0.114 06/23/2014
50 204951 UTSW Nlrp4b 0.072 R1833 G1 225 Y 7 10725936 M455L A T missense Het probably benign 0.001 0.090 06/23/2014
51 204927 UTSW Oaz3 0.287 R1833 G1 192 Y 3 94436042 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG unclassified Het probably benign phenotype 06/23/2014
52 204921 UTSW Olfr1258 0.053 R1833 G1 225 Y 2 89930301 L164* T A nonsense Het probably null 0.976 phenotype 06/23/2014
53 204989 UTSW Olfr286 0.088 R1833 G1 225 Y 15 98226965 I227F T A missense Het probably damaging 0.998 0.812 phenotype 06/23/2014
54 204997 UTSW Pcx 1.000 R1833 G1 225 Y 19 4619104 V710E T A missense Het probably damaging 0.982 0.909 phenotype 06/23/2014
55 204930 UTSW Pkn2 1.000 R1833 G1 225 Y 3 142821647 R347Q C T missense Het probably damaging 1.000 0.132 phenotype 06/23/2014
56 204914 UTSW Qsox1 0.535 R1833 G1 225 Y 1 155791045 G233S C T missense Het probably benign 0.147 0.109 phenotype 06/23/2014
57 204924 UTSW Rbl1 0.000 R1833 G1 225 Y 2 157195555 N224I T A missense Het probably damaging 0.976 0.919 phenotype 06/23/2014
58 204959 UTSW Rspry1 0.526 R1833 G1 225 Y 8 94635488 T132A A G missense Het probably damaging 1.000 0.647 phenotype 06/23/2014
59 204926 UTSW Sclt1 0.326 R1833 G1 225 Y 3 41727111 V91A A G missense Het probably damaging 0.992 0.228 phenotype 06/23/2014
60 204945 UTSW Sema4f 0.000 R1833 G1 225 Y 6 82918559 L331H A T missense Het probably benign 0.017 0.090 phenotype 06/23/2014
61 204963 UTSW Sf3b3 0.966 R1833 G1 225 Y 8 110817566 Q814L T A missense Het probably benign 0.000 0.062 phenotype 06/23/2014
62 204915 UTSW Slc19a2 0.147 R1833 G1 225 Y 1 164262184 Y190D T G missense Het probably damaging 1.000 0.964 phenotype 06/23/2014
63 204969 UTSW Smarcc1 1.000 R1833 G1 225 Y 9 110153811 H204Q T A missense Het possibly damaging 0.711 0.179 phenotype 06/23/2014
64 204957 UTSW Sox6 1.000 R1833 G1 225 Y 7 115777093 K135E T C missense Het probably damaging 1.000 0.180 phenotype 06/23/2014
65 204941 UTSW Tecpr1 0.000 R1833 G1 159 Y 5 144208608 Q607R T C missense Het probably damaging 0.989 0.256 phenotype 06/23/2014
66 204958 UTSW Tgfb1i1 0.361 R1833 G1 207 Y 7 128249498 A G splice site Het probably benign phenotype 06/23/2014
67 204965 UTSW Tirap 0.197 R1833 G1 225 Y 9 35188703 R228S T G missense Het probably benign 0.185 0.090 phenotype 06/23/2014
68 204938 UTSW Tmem211 0.000 R1833 G1 172 Y 5 113234569 A G splice site Het probably benign 06/23/2014
69 204917 UTSW Trp53bp2 1.000 R1833 G1 225 Y 1 182429016 H50Q T A missense Het probably damaging 0.983 0.203 phenotype 06/23/2014
70 204944 UTSW Try4 0.000 R1833 G1 225 Y 6 41303431 H63R A G missense Het probably damaging 0.982 0.922 06/23/2014
71 204947 UTSW Vmn2r25 0.102 R1833 G1 225 Y 6 123839684 P313S G A missense Het probably benign 0.015 0.090 06/23/2014
72 204971 UTSW Vps26a 0.272 R1833 G1 225 Y 10 62459046 L250V A C missense Het probably benign 0.003 0.090 phenotype 06/23/2014
73 204948 UTSW Vwf 0.174 R1833 G1 225 Y 6 125642037 H1226R A G missense Het probably benign 0.142 0.124 phenotype 06/23/2014
74 204934 UTSW Wdtc1 0.000 R1833 G1 195 Y 4 133308742 TCC TC splice site Het probably benign 0.090 phenotype 06/23/2014
75 204942 UTSW Zc3hav1l 0.000 R1833 G1 225 Y 6 38297946 A T splice site Het probably benign 0.090 06/23/2014
76 204996 UTSW Zfp119b 0.054 R1833 G1 225 Y 17 55939271 H305P T G missense Het probably damaging 1.000 0.647 06/23/2014
77 204937 UTSW Zfp326 0.372 R1833 G1 225 Y 5 105891169 Q134* C T nonsense Het probably null 0.971 06/23/2014
78 204956 UTSW Zfp975 0.062 R1833 G1 225 Y 7 42661839 R450Q C T missense Het probably benign 0.006 0.119 06/23/2014
79 204981 UTSW Zfyve26 0.000 R1833 G1 120 Y 12 79286258 M313K A T missense Het probably benign 0.358 0.090 phenotype 06/23/2014
80 204949 UTSW Zscan5b 0.000 R1833 G1 225 Y 7 6238966 S395P T C missense Het possibly damaging 0.669 0.179 06/23/2014
[records 1 to 80 of 80]