Incidental Mutations

113 incidental mutations are currently displayed, and affect 113 genes.
20 are Possibly Damaging.
44 are Probably Damaging.
40 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 113] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 208574 UTSW Adgrg2 0.000 R1864 G1 222 N X 160482351 M532I G A missense Het probably benign 0.010 0.090 phenotype 06/30/2014
2 208544 UTSW Agtpbp1 0.826 R1864 G1 225 N 13 59450202 Y1198H A G missense Het possibly damaging 0.923 phenotype 06/30/2014
3 208483 UTSW Ahcyl2 0.678 R1864 G1 225 N 6 29908355 V575M G A missense Het probably damaging 1.000 0.797 phenotype 06/30/2014
4 208469 UTSW AI314180 0.449 R1864 G1 225 N 4 58849942 H427L T A missense Het possibly damaging 0.617 06/30/2014
5 208442 UTSW Akp3 0.114 R1864 G1 102 N 1 87127767 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC small deletion Het probably benign phenotype 06/30/2014
6 208463 UTSW Ankrd50 0.708 R1864 G1 225 N 3 38454461 N329K A T missense Het probably benign 0.023 06/30/2014
7 208525 UTSW Ano4 0.000 R1864 G1 225 N 10 88971391 G741V C A missense Het probably damaging 1.000 06/30/2014
8 208567 UTSW Anxa1 0.354 R1864 G1 225 N 19 20379689 D191G T C missense Het probably benign 0.001 phenotype 06/30/2014
9 208524 UTSW Apc2 0.231 R1864 G1 225 N 10 80313648 T1512I C T missense Het probably damaging 0.999 phenotype 06/30/2014
10 208517 UTSW Aph1b 0.000 R1864 G1 225 N 9 66794113 C81S A T missense Het probably benign 0.052 phenotype 06/30/2014
11 208445 UTSW Arhgap21 0.244 R1864 G1 225 N 2 20861204 E893G T C missense Het probably damaging 1.000 0.263 phenotype 06/30/2014
12 208547 UTSW Arhgef28 0.000 R1864 G1 225 N 13 97994132 H399Q A T missense Het probably benign 0.001 phenotype 06/30/2014
13 208464 UTSW Asic5 0.000 R1864 G1 225 N 3 82011987 E304G A G missense Het probably benign 0.003 phenotype 06/30/2014
14 208508 UTSW B4galnt4 0.101 R1864 G1 157 N 7 141070533 Y771C A G missense Het probably damaging 0.999 06/30/2014
15 208513 UTSW Birc2 0.869 R1864 G1 225 N 9 7819517 Q465K G T missense Het probably benign 0.058 phenotype 06/30/2014
16 208556 UTSW Btla 0.051 R1864 G1 225 N 16 45250374 T232I C T missense Het probably damaging 0.972 phenotype 06/30/2014
17 208516 UTSW Ccdc84 0.930 R1864 G1 225 N 9 44417721 C66R A G missense Het probably damaging 1.000 phenotype 06/30/2014
18 208534 UTSW Ccl7 0.077 R1864 G1 225 N 11 82046552 K37N G T missense Het probably benign 0.003 phenotype 06/30/2014
19 208526 UTSW Cdk17 0.275 R1864 G1 225 N 10 93226105 V233A T C missense Het probably damaging 0.996 phenotype 06/30/2014
20 208511 UTSW Cilp2 0.000 R1864 G1 148 N 8 69881323 Q1008H C A missense Het probably damaging 1.000 06/30/2014
21 208487 UTSW Clcn1 0.000 R1864 G1 225 N 6 42305541 D442E T A missense Het probably damaging 0.995 0.647 phenotype 06/30/2014
22 208474 UTSW Clcnka 0.000 R1864 G1 225 N 4 141392802 T269A T C missense Het probably damaging 0.986 phenotype 06/30/2014
23 208518 UTSW Col12a1 0.744 R1864 G1 225 N 9 79627103 A T splice site Het probably null phenotype 06/30/2014
24 208545 UTSW Cts6 0.000 R1864 G1 225 N 13 61201579 I105T A G missense Het probably benign 0.262 0.090 06/30/2014
25 208481 UTSW Cyp3a25 0.096 R1864 G1 225 N 5 145994929 D123G T C missense Het probably damaging 0.981 06/30/2014
26 208459 UTSW D630003M21Rik 0.067 R1864 G1 225 N 2 158203185 L808Q A T missense Het probably damaging 1.000 06/30/2014
27 208458 UTSW Ddrgk1 1.000 R1864 G1 225 N 2 130654295 I270N A T missense Het probably damaging 0.997 0.903 phenotype 06/30/2014
28 208479 UTSW Dhx15 0.946 R1864 G1 225 N 5 52184701 T92A T C missense Het possibly damaging 0.528 phenotype 06/30/2014
29 208506 UTSW Dhx32 0.103 R1864 G1 225 N 7 133737296 C197S A T missense Het probably benign 0.001 0.079 phenotype 06/30/2014
30 208572 UTSW Diaph2 R1864 G1 222 N X 129960127 R473Q G A missense Het probably damaging 0.999 phenotype 06/30/2014
31 208562 UTSW Dnd1 0.000 R1864 G1 225 N 18 36766004 C11R A G missense Het possibly damaging 0.928 phenotype 06/30/2014
32 208507 UTSW Dock1 1.000 R1864 G1 225 N 7 135146507 D1566A A C missense Het probably benign 0.070 phenotype 06/30/2014
33 208573 UTSW Drp2 0.114 R1864 G1 201 N X 134427115 I43V A G missense Het probably benign 0.029 phenotype 06/30/2014
34 208542 UTSW Ecm2 0.196 R1864 G1 225 N 13 49530145 V533A T C missense Het probably benign 0.284 0.162 phenotype 06/30/2014
35 208478 UTSW Emilin1 0.143 R1864 G1 225 N 5 30918590 E725G A G missense Het probably damaging 0.998 phenotype 06/30/2014
36 208493 UTSW Eml2 0.000 R1864 G1 189 N 7 19201878 Y487C A G missense Het probably damaging 1.000 06/30/2014
37 208566 UTSW Epg5 0.939 R1864 G1 225 N 18 77975031 L919H T A missense Het probably damaging 0.988 phenotype 06/30/2014
38 208536 UTSW Fam187a 0.117 R1864 G1 225 N 11 102886011 S214T T A missense Het probably damaging 0.998 06/30/2014
39 208570 UTSW Flna 0.784 R1864 G1 222 N X 74240263 T521A T C missense Het probably benign 0.001 phenotype 06/30/2014
40 208528 UTSW Foxi1 0.301 R1864 G1 225 N 11 34207531 I165F T A missense Het probably damaging 0.997 phenotype 06/30/2014
41 208530 UTSW Fxr2 0.742 R1864 G1 205 N 11 69652277 K633N A T missense Het probably benign 0.298 phenotype 06/30/2014
42 208501 UTSW Gdpd5 0.000 R1864 G1 225 N 7 99448999 I209T T C missense Het probably benign 0.038 phenotype 06/30/2014
43 208475 UTSW Gm13212 0.527 R1864 G1 181 N 4 145622428 Q145L A T missense Het possibly damaging 0.919 06/30/2014
44 208541 UTSW Gmpr 0.000 R1864 G1 225 N 13 45542625 V278F G T missense Het probably damaging 0.998 0.273 phenotype 06/30/2014
45 208489 UTSW Grm7 0.000 R1864 G1 225 N 6 111080423 D328V A T missense Het probably benign 0.029 phenotype 06/30/2014
46 208535 UTSW Heatr6 0.808 R1864 G1 225 N 11 83769230 S534P T C missense Het probably damaging 0.974 06/30/2014
47 208571 UTSW Heph 0.000 R1864 G1 222 N X 96529486 T792A A G missense Het probably damaging 1.000 phenotype 06/30/2014
48 208486 UTSW Hipk2 0.954 R1864 G1 225 N 6 38718935 T A critical splice acceptor site Het probably null phenotype 06/30/2014
49 208462 UTSW Hps3 0.151 R1864 G1 225 N 3 20019959 T A critical splice acceptor site Het probably null phenotype 06/30/2014
50 208447 UTSW Hspa5 1.000 R1864 G1 225 N 2 34774541 F336L T C missense Het probably damaging 0.992 0.865 phenotype 06/30/2014
51 208503 UTSW Insc 0.241 R1864 G1 225 N 7 114842178 I409T T C missense Het probably benign 0.060 phenotype 06/30/2014
52 208491 UTSW Kcnj8 1.000 R1864 G1 225 N 6 142570240 H47L T A missense Het probably damaging 0.999 0.442 phenotype 06/30/2014
53 208548 UTSW Kcnma1 0.859 R1864 G1 225 N 14 23803162 Q108L T A missense Het probably damaging 1.000 phenotype 06/30/2014
54 208494 UTSW Klc3 0.172 R1864 G1 210 N 7 19398041 V137A A G missense Het probably damaging 0.979 phenotype 06/30/2014
55 208446 UTSW Lcn2 0.000 R1864 G1 225 N 2 32385422 T194A T C missense Het possibly damaging 0.766 0.179 phenotype 06/30/2014
56 208452 UTSW Lgr4 1.000 R1864 G1 225 N 2 110011397 F576I T A missense Het possibly damaging 0.933 phenotype 06/30/2014
57 208448 UTSW Lypd6b 0.000 R1864 G1 225 N 2 49947447 I144V A G missense Het possibly damaging 0.952 06/30/2014
58 208546 UTSW Mctp1 0.000 R1864 G1 115 N 13 76385148 C205Y G A missense Het possibly damaging 0.629 0.084 06/30/2014
59 208488 UTSW Mitf 0.929 R1864 G1 225 N 6 98010422 N159I A T missense Het probably damaging 1.000 phenotype 06/30/2014
60 208557 UTSW Morc1 0.316 R1864 G1 225 N 16 48592530 I678T T C missense Het probably benign 0.008 phenotype 06/30/2014
61 208554 UTSW Muc4 0.141 R1864 G1 225 N 16 32756251 A G unclassified Het probably benign phenotype 06/30/2014
62 208500 UTSW Myo7a 0.000 R1864 G1 225 N 7 98052256 Y2115C T C missense Het probably damaging 1.000 phenotype 06/30/2014
63 208568 UTSW Myof 0.000 R1864 G1 225 N 19 37986705 I182V T C missense Het probably benign 0.000 phenotype 06/30/2014
64 208529 UTSW Ncor1 1.000 R1864 G1 225 N 11 62381419 V635A A G missense Het probably damaging 0.998 phenotype 06/30/2014
65 208449 UTSW Neb 0.829 R1864 G1 225 N 2 52212760 Y4257* G T nonsense Het probably null phenotype 06/30/2014
66 208468 UTSW Npr2 0.890 R1864 G1 225 N 4 43641258 V428E T A missense Het probably benign 0.298 phenotype 06/30/2014
67 208533 UTSW Nufip2 0.957 R1864 G1 225 N 11 77692298 D346G A G missense Het probably damaging 0.998 06/30/2014
68 208441 UTSW Obsl1 0.202 R1864 G1 225 N 1 75493109 S1088F G A missense Het probably benign 0.014 06/30/2014
69 208451 UTSW Olfr1262 0.056 R1864 G1 225 N 2 90002481 V25E T A missense Het probably benign 0.017 phenotype 06/30/2014
70 208453 UTSW Olfr1282 0.112 R1864 G1 225 N 2 111335707 V124M C T missense Het possibly damaging 0.949 phenotype 06/30/2014
71 208558 UTSW Olfr204 0.105 R1864 G1 225 N 16 59315015 Y131H A G missense Het probably damaging 1.000 phenotype 06/30/2014
72 208502 UTSW Olfr705 0.246 R1864 G1 225 N 7 106713823 N286S T C missense Het possibly damaging 0.865 phenotype 06/30/2014
73 208514 UTSW Olfr877 0.076 R1864 G1 225 N 9 37855264 Y149N T A missense Het probably damaging 0.999 phenotype 06/30/2014
74 208515 UTSW Olfr982 0.183 R1864 G1 225 N 9 40074785 I163M T G missense Het possibly damaging 0.878 phenotype 06/30/2014
75 208565 UTSW Pdgfrb 1.000 R1864 G1 225 N 18 61071717 V550I G A missense Het probably benign 0.002 phenotype 06/30/2014
76 208553 UTSW Pi4ka 1.000 R1864 G1 225 N 16 17367525 L237* A T nonsense Het probably null phenotype 06/30/2014
77 208450 UTSW Pla2r1 0.000 R1864 G1 225 N 2 60428711 T1111M G A missense Het probably benign 0.009 phenotype 06/30/2014
78 208490 UTSW Plxnd1 1.000 R1864 G1 212 N 6 115969441 A T unclassified Het probably null 0.248 phenotype 06/30/2014
79 208549 UTSW Pnp 0.183 R1864 G1 225 N 14 50947973 A67P G C missense Het probably benign 0.001 phenotype 06/30/2014
80 208482 UTSW Ppp1r3a 0.000 R1864 G1 225 N 6 14718405 S837T A T missense Het probably damaging 0.998 0.083 phenotype 06/30/2014
81 208538 UTSW Ppp2r5e 0.000 R1864 G1 225 N 12 75469567 A239P C G missense Het probably damaging 0.997 0.623 phenotype 06/30/2014
82 208457 UTSW Prom2 0.000 R1864 G1 225 N 2 127539787 D203G T C missense Het probably benign 0.005 phenotype 06/30/2014
83 208473 UTSW Pum1 0.861 R1864 G1 225 N 4 130751525 V486A T C missense Het possibly damaging 0.905 phenotype 06/30/2014
84 208465 UTSW Rnf115 0.000 R1864 G1 147 N 3 96727837 A G unclassified Het probably benign 06/30/2014
85 208499 UTSW Rsf1 1.000 R1864 G1 214 N 7 97579904 ATGGCG ATGGCGACGGTGGCG unclassified Het probably benign phenotype 06/30/2014
86 208467 UTSW Rusc2 0.168 R1864 G1 159 N 4 43421719 A713D C A missense Het possibly damaging 0.491 phenotype 06/30/2014
87 208454 UTSW Ryr3 0.391 R1864 G1 225 N 2 112730328 H3009Q A T missense Het possibly damaging 0.652 phenotype 06/30/2014
88 208539 UTSW Serpina1d 0.082 R1864 G1 225 N 12 103767997 C16F C A missense Het probably benign 0.213 06/30/2014
89 208532 UTSW Serpinf2 0.109 R1864 G1 225 N 11 75437483 R80S G T missense Het possibly damaging 0.737 phenotype 06/30/2014
90 208510 UTSW Sh2d4a 0.000 R1864 G1 225 N 8 68329315 Q192K C A missense Het probably benign 0.381 phenotype 06/30/2014
91 208472 UTSW Sh3d21 0.084 R1864 G1 225 N 4 126150936 T A critical splice acceptor site Het probably null 06/30/2014
92 208563 UTSW Sh3rf2 0.000 R1864 G1 225 N 18 42053981 L55Q T A missense Het probably damaging 0.990 06/30/2014
93 208456 UTSW Shc4 0.214 R1864 G1 225 N 2 125639367 D255G T C missense Het probably damaging 1.000 06/30/2014
94 208471 UTSW Skint2 0.067 R1864 G1 225 N 4 112625909 H170Q T A missense Het probably benign 0.096 06/30/2014
95 208480 UTSW Slc29a4 0.000 R1864 G1 225 N 5 142717754 Y261C A G missense Het probably damaging 0.999 phenotype 06/30/2014
96 208555 UTSW Slc35a5 0.148 R1864 G1 225 N 16 45143708 N102K A T missense Het possibly damaging 0.662 phenotype 06/30/2014
97 208520 UTSW Slc38a3 0.653 R1864 G1 225 N 9 107655953 I307K A T missense Het probably damaging 1.000 phenotype 06/30/2014
98 208498 UTSW Sv2b 0.000 R1864 G1 225 N 7 75124080 S548T A T missense Het probably benign 0.168 phenotype 06/30/2014
99 208543 UTSW Tgfbi 0.166 R1864 G1 225 N 13 56632881 S524P T C missense Het probably benign 0.156 phenotype 06/30/2014
100 208455 UTSW Tgm5 0.127 R1864 G1 187 N 2 121075218 D152G T C missense Het probably damaging 0.999 phenotype 06/30/2014
[records 1 to 100 of 113] next >> last >|