Incidental Mutations

105 incidental mutations are currently displayed, and affect 105 genes.
20 are Possibly Damaging.
39 are Probably Damaging.
38 are Probably Benign.
7 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 105] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 210998 UTSW AA986860 0.068 R1874 G1 225 Y 1 130742691 S217G A G missense Het probably benign 0.057 0.072 06/30/2014
2 211053 UTSW Adrb3 0.302 R1874 G1 225 Y 8 27227563 R286L C A missense Het probably damaging 0.999 0.402 phenotype 06/30/2014
3 211086 UTSW Akap11 0.000 R1874 G1 225 Y 14 78511866 D1027V T A missense Het probably benign 0.141 0.086 phenotype 06/30/2014
4 211063 UTSW Ank3 0.856 R1874 G1 225 Y 10 69898083 I726F A T missense Het probably damaging 0.999 0.414 phenotype 06/30/2014
5 211075 UTSW Ankmy2 0.749 R1874 G1 225 Y 12 36165931 D43E T A missense Het possibly damaging 0.773 0.179 06/30/2014
6 211082 UTSW Ankrd34b 0.057 R1874 G1 225 Y 13 92439556 D432G A G missense Het probably damaging 0.989 0.403 06/30/2014
7 211008 UTSW Ano3 0.082 R1874 G1 225 Y 2 110884872 S74A A C missense Het probably benign 0.004 0.086 phenotype 06/30/2014
8 211050 UTSW B4galnt4 0.119 R1874 G1 225 Y 7 141070526 S769T T A missense Het probably damaging 0.995 0.418 06/30/2014
9 211099 UTSW Bicral 1.000 R1874 G1 225 Y 17 46825178 T369S T A missense Het probably benign 0.300 0.059 phenotype 06/30/2014
10 211045 UTSW Blm 1.000 R1874 G1 225 Y 7 80497418 L738P A G missense Het probably damaging 1.000 0.973 phenotype 06/30/2014
11 211009 UTSW Bpifb3 0.000 R1874 G1 225 Y 2 153925840 T278A A G missense Het probably benign 0.006 0.090 phenotype 06/30/2014
12 211010 UTSW Bpifb5 0.000 R1874 G1 132 Y 2 154227202 A G splice site Het probably benign 06/30/2014
13 211101 UTSW Brd8 1.000 R1874 G1 225 Y 18 34610474 P266R G C missense Het probably damaging 1.000 0.095 phenotype 06/30/2014
14 211106 UTSW Btaf1 0.963 R1874 G1 225 Y 19 36980583 M587L A T missense Het probably benign 0.000 0.060 phenotype 06/30/2014
15 211019 UTSW Casz1 1.000 R1874 G1 221 N 4 148943211 T1015S C G missense Het probably damaging 0.986 phenotype 06/30/2014
16 211061 UTSW Cdh23 0.617 R1874 G1 225 Y 10 60436818 I524T A G missense Het possibly damaging 0.518 0.146 phenotype 06/30/2014
17 211058 UTSW Celsr3 1.000 R1874 G1 225 Y 9 108835838 V1825A T C missense Het probably benign 0.000 0.090 phenotype 06/30/2014
18 211004 UTSW Cenpf 0.664 R1874 G1 225 Y 1 189683816 L104P A G missense Het probably damaging 1.000 0.774 phenotype 06/30/2014
19 210996 UTSW Clasp1 0.953 R1874 G1 206 Y 1 118600585 G T critical splice donor site 1 bp Het probably null 0.958 phenotype 06/30/2014
20 211052 UTSW Coprs 0.138 R1874 G1 225 Y 8 13885112 W148R A G missense Het probably damaging 1.000 0.513 phenotype 06/30/2014
21 211011 UTSW Cpne1 0.804 R1874 G1 225 Y 2 156078382 S168P A G missense Het probably damaging 0.986 0.265 phenotype 06/30/2014
22 211049 UTSW Cpxm2 0.074 R1874 G1 225 Y 7 132059834 Y408C T C missense Het probably damaging 1.000 0.962 06/30/2014
23 211062 UTSW Ctnna3 0.233 R1874 G1 225 Y 10 63504107 E24G A G missense Het possibly damaging 0.671 0.883 phenotype 06/30/2014
24 211005 UTSW Cubn 1.000 R1874 G1 225 Y 2 13323002 S2671C T A missense Het probably damaging 0.999 0.647 phenotype 06/30/2014
25 211095 UTSW Cyp4f39 0.289 R1874 G1 225 Y 17 32483324 F265Y T A missense Het probably damaging 0.997 0.435 phenotype 06/30/2014
26 211023 UTSW Dgkq 0.000 R1874 G1 225 Y 5 108660595 R34L C A missense Het probably benign 0.073 0.072 phenotype 06/30/2014
27 211069 UTSW Dnajc7 0.000 R1874 G1 225 Y 11 100599313 C T splice site Het probably benign phenotype 06/30/2014
28 211067 UTSW Eml6 0.297 R1874 G1 225 Y 11 29831136 D632A T G missense Het probably damaging 0.993 0.124 06/30/2014
29 211030 UTSW Fbxl18 0.076 R1874 G1 225 Y 5 142886223 A419V G A missense Het probably damaging 0.959 0.217 phenotype 06/30/2014
30 211059 UTSW Fbxw22 0.063 R1874 G1 225 Y 9 109385111 C212* A T nonsense Het probably null 0.976 06/30/2014
31 211038 UTSW Ffar2 0.000 R1874 G1 225 Y 7 30819414 A G unclassified 272 bp Het probably null 0.940 phenotype 06/30/2014
32 211013 UTSW Fga 0.304 R1874 G1 225 Y 3 83032721 T561S A T missense Het probably damaging 0.999 0.059 phenotype 06/30/2014
33 211031 UTSW Fry 0.692 R1874 G1 225 Y 5 150345921 Y159C A G missense Het probably damaging 0.999 0.297 06/30/2014
34 211064 UTSW Gal3st1 0.000 R1874 G1 225 Y 11 3998231 Y146C A G missense Het probably damaging 0.999 0.314 phenotype 06/30/2014
35 211007 UTSW Gapvd1 1.000 R1874 G1 225 Y 2 34706021 H788Q A T missense Het probably damaging 0.999 0.647 06/30/2014
36 211034 UTSW Gimap7 0.087 R1874 G1 225 Y 6 48723515 V12I G A missense Het possibly damaging 0.810 0.082 phenotype 06/30/2014
37 210997 UTSW Gli2 1.000 R1874 G1 225 Y 1 119002049 A43S C A missense Het possibly damaging 0.834 0.063 phenotype 06/30/2014
38 211025 UTSW Gm15446 0.057 R1874 G1 159 Y 5 109942553 F224L T C missense Het probably damaging 0.989 0.647 06/30/2014
39 258032 UTSW Gm21738 0.877 R1874 G1 22 Y 14 19418824 V35I C T missense Het possibly damaging 0.638 0.179 01/16/2015
40 211074 UTSW Grhl1 0.000 R1874 G1 225 Y 12 24586156 T C splice site Het probably benign phenotype 06/30/2014
41 211081 UTSW Grk6 0.000 R1874 G1 225 Y 13 55450273 Y53H T C missense Het probably damaging 0.999 0.917 phenotype 06/30/2014
42 211029 UTSW Hcar1 0.095 R1874 G1 225 Y 5 123879265 R121K C T missense Het probably damaging 0.998 0.829 phenotype 06/30/2014
43 210999 UTSW Hmcn1 0.000 R1874 G1 225 Y 1 150720695 S1797A A C missense Het probably damaging 0.998 0.212 phenotype 06/30/2014
44 211001 UTSW Hsd17b7 1.000 R1874 G1 225 Y 1 169955993 L282Q A T missense Het possibly damaging 0.702 0.414 phenotype 06/30/2014
45 210995 UTSW Irs1 0.551 R1874 G1 108 Y 1 82289853 TTCTCTGAGTGGCCACAGCGTCT TTCT frame shift Het probably null phenotype 06/30/2014
46 211020 UTSW Kif1b 1.000 R1874 G1 225 Y 4 149187632 V1571I C T missense Het probably benign 0.000 0.090 phenotype 06/30/2014
47 211054 UTSW Lpl 1.000 R1874 G1 225 Y 8 68896619 C266S T A missense Het probably damaging 1.000 0.975 phenotype 06/30/2014
48 211039 UTSW Mag 0.000 R1874 G1 225 Y 7 30909051 H213Y G A missense Het probably benign 0.126 0.161 phenotype 06/30/2014
49 211036 UTSW Mansc4 0.075 R1874 G1 225 Y 6 147075190 R309S T G missense Het probably benign 0.013 0.090 06/30/2014
50 211077 UTSW Mlh3 0.000 R1874 G1 225 Y 12 85237513 A G critical splice donor site 2 bp Het probably null 0.949 phenotype 06/30/2014
51 211002 UTSW Mndal 0.109 R1874 G1 225 Y 1 173860367 G A unclassified Het probably benign 06/30/2014
52 211043 UTSW Mrgpra2b 0.064 R1874 G1 225 Y 7 47463994 E330V T A missense Het probably damaging 0.993 0.647 06/30/2014
53 211068 UTSW Myh3 0.346 R1874 G1 225 Y 11 67093179 I990V A G missense Het probably benign 0.027 0.069 phenotype 06/30/2014
54 211014 UTSW Myoz2 0.090 R1874 G1 225 Y 3 123026116 S65T A T missense Het probably damaging 1.000 0.153 phenotype 06/30/2014
55 211087 UTSW Naa16 0.099 R1874 G1 225 Y 14 79355743 E463G T C missense Het possibly damaging 0.616 0.116 06/30/2014
56 211051 UTSW Nadsyn1 0.000 R1874 G1 225 N 7 143797844 F684S A G missense Het probably damaging 1.000 phenotype 06/30/2014
57 211006 UTSW Notch1 1.000 R1874 G1 225 Y 2 26481579 E286G T C missense Het possibly damaging 0.895 0.238 phenotype 06/30/2014
58 211084 UTSW Nynrin 0.000 R1874 G1 225 Y 14 55863493 I247L A T missense Het probably benign 0.041 0.090 06/30/2014
59 211098 UTSW Olfr136 0.165 R1874 G1 225 Y 17 38335969 P271S C T missense Het probably damaging 1.000 0.647 phenotype 06/30/2014
60 211047 UTSW Olfr644 0.221 R1874 G1 225 Y 7 104068129 I301V T C missense Het probably null 0.999 0.434 phenotype 06/30/2014
61 211056 UTSW Olfr981 0.183 R1874 G1 225 Y 9 40022855 I154N T A missense Het possibly damaging 0.858 0.094 phenotype 06/30/2014
62 211060 UTSW Oprm1 0.097 R1874 G1 225 Y 10 6789035 H54R A G missense Het probably benign 0.174 0.090 phenotype 06/30/2014
63 211073 UTSW P4hb 0.498 R1874 G1 225 Y 11 120562166 D483N C T missense Het probably benign 0.000 0.088 phenotype 06/30/2014
64 211046 UTSW Pak1 0.000 R1874 G1 225 Y 7 97871580 S149P T C missense Het probably benign 0.232 0.062 phenotype 06/30/2014
65 211015 UTSW Pars2 0.878 R1874 G1 225 Y 4 106653716 F232L T C missense Het possibly damaging 0.750 0.098 phenotype 06/30/2014
66 211057 UTSW Pih1d2 0.062 R1874 G1 225 Y 9 50620945 M88V A G missense Het possibly damaging 0.683 0.179 06/30/2014
67 210993 UTSW Pms1 0.000 R1874 G1 225 Y 1 53207233 N382K A T missense Het probably benign 0.163 0.360 phenotype 06/30/2014
68 211107 UTSW Pnliprp2 0.100 R1874 G1 225 Y 19 58763389 V189L G T missense Het probably benign 0.003 0.090 phenotype 06/30/2014
69 211026 UTSW Pole 1.000 R1874 G1 225 Y 5 110323664 V1425M G A missense Het possibly damaging 0.809 0.179 phenotype 06/30/2014
70 211100 UTSW Pot1b 0.000 R1874 G1 225 Y 17 55654805 Q591L T A missense Het probably benign 0.000 0.090 phenotype 06/30/2014
71 211032 UTSW Ppp1r9a 0.603 R1874 G1 225 Y 6 4906348 T301M C T missense Het possibly damaging 0.871 0.179 phenotype 06/30/2014
72 211037 UTSW Psg21 0.052 R1874 G1 104 Y 7 18650816 E335G T C missense Het probably benign 0.150 0.418 06/30/2014
73 211018 UTSW Ptpru 0.000 R1874 G1 225 Y 4 131769755 M1416L T A missense Het probably benign 0.000 0.064 phenotype 06/30/2014
74 211027 UTSW Pxn 1.000 R1874 G1 136 N 5 115544990 V117A T C missense Het probably damaging 0.997 phenotype 06/30/2014
75 211000 UTSW Qsox1 0.621 R1874 G1 196 Y 1 155812639 R54H C T missense Het possibly damaging 0.845 0.191 phenotype 06/30/2014
76 211089 UTSW Rad1 0.942 R1874 G1 225 Y 15 10488006 E42G A G missense Het probably damaging 0.997 0.406 phenotype 06/30/2014
77 211083 UTSW Rpp14 0.934 R1874 G1 225 Y 14 8090145 Y23C A G missense Het probably benign 0.000 0.090 06/30/2014
78 211071 UTSW Sdk2 0.128 R1874 G1 225 Y 11 113834956 V1156I C T missense Het probably benign 0.004 0.090 phenotype 06/30/2014
79 211078 UTSW Serpina3j 0.059 R1874 G1 225 Y 12 104319699 R371L G T missense Het probably benign 0.002 0.090 06/30/2014
80 211079 UTSW Serpinb9d 0.105 R1874 G1 225 Y 13 33197963 T A splice site Het probably null 0.976 06/30/2014
81 211080 UTSW Sirt5 0.000 R1874 G1 225 Y 13 43370791 S13F C T missense Het possibly damaging 0.921 0.196 phenotype 06/30/2014
82 211103 UTSW Slc6a7 0.115 R1874 G1 225 Y 18 61001398 T A splice site Het probably benign phenotype 06/30/2014
83 211092 UTSW Slx4 1.000 R1874 G1 225 Y 16 3986848 S701P A G missense Het probably benign 0.254 0.107 phenotype 06/30/2014
84 211093 UTSW Snx29 0.000 R1874 G1 212 Y 16 11367681 T43A A G missense Het probably benign 0.009 0.071 06/30/2014
85 210994 UTSW Speg 1.000 R1874 G1 225 Y 1 75423906 V2570A T C missense Het probably benign 0.000 0.060 phenotype 06/30/2014
86 211028 UTSW Srrm4 0.268 R1874 G1 225 Y 5 116453506 T A utr 3 prime Het probably benign 0.060 phenotype 06/30/2014
87 211102 UTSW Stk32a 0.080 R1874 G1 225 Y 18 43261316 Y110C A G missense Het probably damaging 1.000 0.643 06/30/2014
88 211091 UTSW Tbc1d31 0.000 R1874 G1 225 Y 15 57916110 G73E G A missense Het probably benign 0.405 0.097 06/30/2014
89 211033 UTSW Thsd7a 0.000 R1874 G1 225 Y 6 12555435 I150N A T missense Het possibly damaging 0.764 0.131 phenotype 06/30/2014
90 211044 UTSW Tjp1 1.000 R1874 G1 225 Y 7 65319253 D699E A T missense Het probably damaging 1.000 0.077 phenotype 06/30/2014
91 211041 UTSW Tmem143 0.057 R1874 G1 225 Y 7 45916564 D437G A G missense Het possibly damaging 0.682 0.306 06/30/2014
92 211094 UTSW Tmem45a2 0.070 R1874 G1 225 Y 16 57047084 Y85H A G missense Het possibly damaging 0.859 0.179 06/30/2014
93 211055 UTSW Tmem45b 0.063 R1874 G1 225 Y 9 31429087 T7S T A missense Het probably damaging 0.998 0.314 06/30/2014
94 211021 UTSW Ube4b 1.000 R1874 G1 225 Y 4 149347971 L832P A G missense Het probably damaging 0.996 0.925 phenotype 06/30/2014
95 211066 UTSW Ugp2 0.000 R1874 G1 225 Y 11 21329048 F379L G T missense Het probably damaging 1.000 0.647 phenotype 06/30/2014
96 211088 UTSW Ugt3a2 0.055 R1874 G1 225 Y 15 9365351 D350V A T missense Het probably damaging 0.997 0.832 06/30/2014
97 211024 UTSW Vmn2r8 0.130 R1874 G1 225 Y 5 108802418 T188S T A missense Het possibly damaging 0.736 0.179 06/30/2014
98 211097 UTSW Vwa7 0.056 R1874 G1 225 Y 17 35017112 P14R C G missense Het probably benign 0.004 0.090 06/30/2014
99 211065 UTSW Vwc2 0.090 R1874 G1 225 Y 11 11261495 T317K C A missense Het probably damaging 0.973 0.203 phenotype 06/30/2014
100 211035 UTSW Vwf 0.217 R1874 G1 225 Y 6 125628372 Q906L A T missense Het probably benign 0.001 0.090 phenotype 06/30/2014
[records 1 to 100 of 105] next >> last >|