Incidental Mutations

81 incidental mutations are currently displayed, and affect 80 genes.
14 are Possibly Damaging.
31 are Probably Damaging.
24 are Probably Benign.
11 are Probably Null.
2 create premature stop codons.
3 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 81 of 81] per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 211175 UTSW 3632451O06Rik 0.000 R1875 G1 225 Y 14 49682358 D772G T C missense Het probably damaging 1.000 0.374 06/30/2014
2 211145 UTSW Abca14 0.000 R1875 G1 225 Y 7 120247967 M685L A T missense Het possibly damaging 0.781 0.065 06/30/2014
3 211183 UTSW Abi3bp 0.081 R1875 G1 225 Y 16 56574499 Y190C A G missense Het probably damaging 1.000 0.801 06/30/2014
4 211150 UTSW Adam26a 0.000 R1875 G1 225 Y 8 43569851 V201L C A missense Het probably benign 0.366 0.090 phenotype 06/30/2014
5 211182 UTSW Adamts20 0.132 R1875 G1 225 Y 15 94331396 D947E G T missense Het probably benign 0.008 0.062 phenotype 06/30/2014
6 211137 UTSW Ankrd26 0.000 R1875 G1 225 Y 6 118540449 A G critical splice donor site 2 bp Het probably null 0.939 phenotype 06/30/2014
7 211181 UTSW Apol11a 0.061 R1875 G1 225 Y 15 77513566 T39N C A missense Het possibly damaging 0.805 0.536 06/30/2014
8 211120 UTSW Arhgef38 0.000 R1875 G1 225 Y 3 133133740 T A critical splice acceptor site Het probably null 0.938 06/30/2014
9 211115 UTSW Atp11b 0.235 R1875 G1 225 Y 3 35839147 L883P T C missense Het probably damaging 1.000 0.926 phenotype 06/30/2014
10 211165 UTSW Btnl10 0.075 R1875 G1 225 Y 11 58923760 I422N T A missense Het probably damaging 0.971 0.604 06/30/2014
11 211141 UTSW C2cd3 1.000 R1875 G1 225 Y 7 100407025 K547E A G missense Het possibly damaging 0.889 0.062 phenotype 06/30/2014
12 211190 UTSW Cdh2 1.000 R1875 G1 225 Y 18 16624877 L549F T A missense Het probably benign 0.000 0.058 phenotype 06/30/2014
13 211157 UTSW Celsr3 1.000 R1875 G1 225 Y 9 108835838 V1825A T C missense Het probably benign 0.000 0.090 phenotype 06/30/2014
14 211111 UTSW Cfap221 0.000 R1875 G1 225 Y 1 119953659 I358V T C missense Het probably benign 0.080 0.090 06/30/2014
15 211149 UTSW Csmd1 0.000 R1875 G1 225 Y 8 15929101 K2828E T C missense Het probably damaging 0.993 0.205 phenotype 06/30/2014
16 211188 UTSW Ddah2 0.154 R1875 G1 225 Y 17 35060845 F137S T C missense Het probably damaging 1.000 0.943 phenotype 06/30/2014
17 211158 UTSW Ddx21 1.000 R1875 G1 225 Y 10 62594068 I299T A G missense Het probably damaging 0.999 0.851 phenotype 06/30/2014
18 211109 UTSW Dnah7a 0.141 R1875 G1 225 Y 1 53456532 A T splice site Het probably benign 0.090 06/30/2014
19 211156 UTSW Elmod1 0.000 R1875 G1 225 Y 9 53935867 I9T A G missense Het probably benign 0.002 0.059 phenotype 06/30/2014
20 211124 UTSW Epha2 0.757 R1875 G1 211 Y 4 141308979 E242G A G missense Het probably benign 0.016 0.112 phenotype 06/30/2014
21 211161 UTSW Erbb3 1.000 R1875 G1 225 Y 10 128574466 H641R T C missense Het possibly damaging 0.706 0.145 phenotype 06/30/2014
22 211133 UTSW Fbxl18 0.070 R1875 G1 225 Y 5 142886223 A419V G A missense Het probably damaging 0.959 0.217 phenotype 06/30/2014
23 211154 UTSW Fli1 0.648 R1875 G1 225 Y 9 32423913 M408V T C missense Het probably benign 0.032 0.085 phenotype 06/30/2014
24 211113 UTSW Fmo4 0.107 R1875 G1 225 Y 1 162803618 N260S T C missense Het possibly damaging 0.946 0.107 phenotype 06/30/2014
25 211134 UTSW Fry 0.666 R1875 G1 225 Y 5 150326132 E136G A G missense Het probably damaging 1.000 0.256 06/30/2014
26 211194 UTSW Gm10477 0.091 R1875 G1 222 Y X 56524767 F9Y T A missense Het probably damaging 0.998 0.430 06/30/2014
27 211132 UTSW Gm8258 0.224 R1875 G1 225 Y 5 104776454 A G exon Het noncoding transcript 0.125 06/30/2014
28 211172 UTSW Gpr68 0.000 R1875 G1 225 Y 12 100878790 D165V T A missense Het probably damaging 1.000 0.273 phenotype 06/30/2014
29 211130 UTSW Htt 1.000 R1875 G1 225 Y 5 34794112 M139K T A missense Het probably benign 0.050 0.482 phenotype 06/30/2014
30 211169 UTSW Jup 1.000 R1875 G1 113 N 11 100372294 A G splice site 2 bp Het probably null phenotype 06/30/2014
31 211185 UTSW Kifc5b 0.314 R1875 G1 89 N 17 26917290 G A splice site 5 bp Het probably null 06/30/2014
32 211135 UTSW Krba1 0.068 R1875 G1 225 Y 6 48414049 T A splice site Het probably null 0.976 06/30/2014
33 211148 UTSW Lamp1 0.000 R1875 G1 225 Y 8 13167257 G89R G A missense Het probably damaging 0.997 0.673 phenotype 06/30/2014
34 211121 UTSW Lexm 0.059 R1875 G1 225 Y 4 106613256 G A splice site Het probably benign phenotype 06/30/2014
35 211128 UTSW Lrrc17 0.000 R1875 G1 225 Y 5 21560652 S44F C T missense Het possibly damaging 0.847 0.095 phenotype 06/30/2014
36 211186 UTSW Mdga1 0.211 R1875 G1 142 Y 17 29852607 T347A T C missense Het probably damaging 0.995 0.155 phenotype 06/30/2014
37 211138 UTSW Mical3 0.205 R1875 G1 225 Y 6 121042064 W66R A T missense Het probably damaging 1.000 0.829 06/30/2014
38 211123 UTSW Mpl 0.000 R1875 G1 225 Y 4 118456829 Y73H A G missense Het probably benign 0.000 0.090 phenotype 06/30/2014
39 211126 UTSW Mterf1b 0.246 R1875 G1 225 Y 5 4197364 I335N T A missense Het possibly damaging 0.956 0.179 phenotype 06/30/2014
40 211152 UTSW Mylk3 0.214 R1875 G1 225 Y 8 85352865 I388T A G missense Het probably damaging 0.999 0.405 phenotype 06/30/2014
41 211166 UTSW Myo15 0.000 R1875 G1 147 Y 11 60507528 R2775W C T missense Het probably damaging 0.988 0.647 phenotype 06/30/2014
42 211119 UTSW Myoz2 0.090 R1875 G1 225 Y 3 123026116 S65T A T missense Het probably damaging 1.000 0.153 phenotype 06/30/2014
43 211179 UTSW Ndrg1 0.000 R1875 G1 225 Y 15 66931091 T137A T C missense Het possibly damaging 0.911 0.437 phenotype 06/30/2014
44 211151 UTSW Neil3 0.559 R1875 G1 225 Y 8 53599419 N381K G T missense Het probably damaging 1.000 0.336 phenotype 06/30/2014
45 211110 UTSW Obsl1 0.262 R1875 G1 225 Y 1 75498233 Y841C T C missense Het probably damaging 1.000 0.572 06/30/2014
46 211189 UTSW Olfr124 0.061 R1875 G1 225 Y 17 37805105 A G start gained Het probably benign phenotype 06/30/2014
47 211142 UTSW Olfr711 0.056 R1875 G1 225 Y 7 106972182 S54F G A missense Het possibly damaging 0.864 0.375 phenotype 06/30/2014
48 211160 UTSW Otogl 0.000 R1875 G1 225 Y 10 107899590 D111G T C missense Het probably damaging 1.000 0.332 phenotype 06/30/2014
49 211180 UTSW Parp10 0.143 R1875 G1 223 Y 15 76242851 E103G T C missense Het probably damaging 1.000 0.082 phenotype 06/30/2014
50 211122 UTSW Pars2 0.872 R1875 G1 225 Y 4 106653716 F232L T C missense Het possibly damaging 0.750 0.098 phenotype 06/30/2014
51 211116 UTSW Pcdh18 0.000 R1875 G1 225 Y 3 49754705 F720L A T missense Het probably damaging 0.985 0.192 phenotype 06/30/2014
52 211108 UTSW Phf3 0.000 R1875 G1 225 Y 1 30830623 E448G T C missense Het possibly damaging 0.805 0.061 phenotype 06/30/2014
53 211112 UTSW Pigc 0.000 R1875 G1 225 Y 1 161970947 Y166C A G missense Het probably damaging 0.988 0.812 phenotype 06/30/2014
54 211144 UTSW Pik3c2a 1.000 R1875 G1 225 Y 7 116417971 S184T A T missense Het probably benign 0.349 0.090 phenotype 06/30/2014
55 211162 UTSW Pkd1l1 1.000 R1875 G1 225 Y 11 8844670 A G splice site Het probably benign 0.090 phenotype 06/30/2014
56 211125 UTSW Plch2 0.000 R1875 G1 217 Y 4 154998508 S485F G A missense Het probably damaging 1.000 0.175 phenotype 06/30/2014
57 211136 UTSW Plxnd1 1.000 R1875 G1 194 Y 6 115978084 G T splice site Het probably null 0.976 phenotype 06/30/2014
58 211193 UTSW Pnliprp2 0.112 R1875 G1 225 Y 19 58763389 V189L G T missense Het probably benign 0.003 0.090 phenotype 06/30/2014
59 211174 UTSW Prl8a2 0.072 R1875 G1 225 Y 13 27351054 V103A T C missense Het probably benign 0.016 0.090 phenotype 06/30/2014
60 211140 UTSW Psg23 0.000 R1875 G1 225 Y 7 18610450 T360I G A missense Het probably benign 0.103 0.090 phenotype 06/30/2014
61 211168 UTSW Rad51c 1.000 R1875 G1 225 Y 11 87388643 I323N A T missense Het probably damaging 0.993 0.763 phenotype 06/30/2014
62 211127 UTSW Rsbn1l 0.169 R1875 G1 175 Y 5 20951698 E30K C T missense Het probably benign 0.172 0.090 06/30/2014
63 211173 UTSW Serpina3c 0.000 R1875 G1 225 Y 12 104151886 L64F C A missense Het probably damaging 0.999 0.647 06/30/2014
64 211164 UTSW Shroom1 0.139 R1875 G1 225 Y 11 53465675 D392G A G missense Het probably damaging 0.991 0.647 phenotype 06/30/2014
65 211129 UTSW Slc26a5 0.000 R1875 G1 225 Y 5 21815727 I540L T A missense Het probably benign 0.031 0.082 phenotype 06/30/2014
66 211155 UTSW Slc37a4 1.000 R1875 G1 225 Y 9 44401511 T321A A G missense Het probably damaging 0.980 0.164 phenotype 06/30/2014
67 211159 UTSW Slc41a2 0.247 R1875 G1 225 Y 10 83256085 L438S A G missense Het probably damaging 0.998 0.115 06/30/2014
68 211176 UTSW Spef2 0.102 R1875 G1 225 Y 15 9584108 E1624K C T missense Het probably damaging 0.957 0.289 phenotype 06/30/2014
69 211177 UTSW Spef2 0.102 R1875 G1 225 Y 15 9597401 G1390R C T missense Het possibly damaging 0.782 0.264 phenotype 06/30/2014
70 211184 UTSW Synj2 0.156 R1875 G1 225 Y 17 6028550 A740S G T missense Het possibly damaging 0.690 0.082 phenotype 06/30/2014
71 211131 UTSW Thegl 0.063 R1875 G1 225 Y 5 77054584 K284M A T missense Het probably benign 0.292 0.090 06/30/2014
72 211118 UTSW Tigd4 0.141 R1875 G1 225 Y 3 84595087 D437A A C missense Het probably benign 0.001 0.063 phenotype 06/30/2014
73 211191 UTSW Timm21 0.000 R1875 G1 225 Y 18 84949262 L130V G C missense Het probably damaging 1.000 0.767 06/30/2014
74 211170 UTSW Tmem106a 0.114 R1875 G1 101 Y 11 101586378 CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA unclassified Het probably benign 06/30/2014
75 211117 UTSW Tmem131l 0.126 R1875 G1 219 Y 3 83905076 C1313* A T nonsense Het probably null 0.964 06/30/2014
76 211139 UTSW Tmem86b 0.000 R1875 G1 225 Y 7 4629699 I47N A T missense Het possibly damaging 0.940 0.179 06/30/2014
77 211171 UTSW Tspan13 0.104 R1875 G1 225 Y 12 36020551 T C splice site 1261 bp Het probably null 0.095 phenotype 06/30/2014
78 211163 UTSW Vps54 0.928 R1875 G1 225 Y 11 21300251 T396A A G missense Het probably benign 0.001 0.059 phenotype 06/30/2014
79 211114 UTSW Zfp106 0.000 R1875 G1 225 Y 2 120513615 A T critical splice donor site 2 bp Het probably null 0.958 phenotype 06/30/2014
80 211147 UTSW Zfp668 0.118 R1875 G1 193 Y 7 127866482 T C splice site 1559 bp Het probably null 0.159 06/30/2014
81 211153 UTSW Zfp809 0.147 R1875 G1 225 Y 9 22238731 R175* A T nonsense Het probably null 0.976 phenotype 06/30/2014
[records 1 to 81 of 81]