Incidental Mutations

81 incidental mutations are currently displayed, and affect 80 genes.
14 are Possibly Damaging.
31 are Probably Damaging.
24 are Probably Benign.
11 are Probably Null.
2 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 81 of 81] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 211175 UTSW 3632451O06Rik 0.000 R1875 G1 225 Y 14 49682358 D772G T C missense Het probably damaging 1.000 0.374 06/30/2014
2 211145 UTSW Abca14 0.000 R1875 G1 225 Y 7 120247967 M685L A T missense Het possibly damaging 0.781 0.065 06/30/2014
3 211183 UTSW Abi3bp 0.081 R1875 G1 225 Y 16 56574499 Y190C A G missense Het probably damaging 1.000 0.801 06/30/2014
4 211150 UTSW Adam26a 0.000 R1875 G1 225 Y 8 43569851 V201L C A missense Het probably benign 0.366 0.090 phenotype 06/30/2014
5 211182 UTSW Adamts20 0.132 R1875 G1 225 Y 15 94331396 D947E G T missense Het probably benign 0.008 0.062 phenotype 06/30/2014
6 211137 UTSW Ankrd26 0.000 R1875 G1 225 Y 6 118540449 A G critical splice donor site 2 bp Het probably null 0.939 phenotype 06/30/2014
7 211181 UTSW Apol11a 0.061 R1875 G1 225 Y 15 77513566 T39N C A missense Het possibly damaging 0.805 0.536 06/30/2014
8 211120 UTSW Arhgef38 0.000 R1875 G1 225 Y 3 133133740 T A critical splice acceptor site Het probably null 0.938 06/30/2014
9 211115 UTSW Atp11b 0.235 R1875 G1 225 Y 3 35839147 L883P T C missense Het probably damaging 1.000 0.926 phenotype 06/30/2014
10 211165 UTSW Btnl10 0.075 R1875 G1 225 Y 11 58923760 I422N T A missense Het probably damaging 0.971 0.604 06/30/2014
11 211141 UTSW C2cd3 1.000 R1875 G1 225 Y 7 100407025 K547E A G missense Het possibly damaging 0.889 0.062 phenotype 06/30/2014
12 211190 UTSW Cdh2 1.000 R1875 G1 225 Y 18 16624877 L549F T A missense Het probably benign 0.000 0.058 phenotype 06/30/2014
13 211157 UTSW Celsr3 1.000 R1875 G1 225 Y 9 108835838 V1825A T C missense Het probably benign 0.000 0.090 phenotype 06/30/2014
14 211111 UTSW Cfap221 0.000 R1875 G1 225 Y 1 119953659 I358V T C missense Het probably benign 0.080 0.090 06/30/2014
15 211149 UTSW Csmd1 0.000 R1875 G1 225 Y 8 15929101 K2828E T C missense Het probably damaging 0.993 0.205 phenotype 06/30/2014
16 211188 UTSW Ddah2 0.154 R1875 G1 225 Y 17 35060845 F137S T C missense Het probably damaging 1.000 0.943 phenotype 06/30/2014
17 211158 UTSW Ddx21 1.000 R1875 G1 225 Y 10 62594068 I299T A G missense Het probably damaging 0.999 0.851 phenotype 06/30/2014
18 211109 UTSW Dnah7a 0.141 R1875 G1 225 Y 1 53456532 A T splice site Het probably benign 0.090 06/30/2014
19 211156 UTSW Elmod1 0.000 R1875 G1 225 Y 9 53935867 I9T A G missense Het probably benign 0.002 0.059 phenotype 06/30/2014
20 211124 UTSW Epha2 0.757 R1875 G1 211 Y 4 141308979 E242G A G missense Het probably benign 0.016 0.112 phenotype 06/30/2014
21 211161 UTSW Erbb3 1.000 R1875 G1 225 Y 10 128574466 H641R T C missense Het possibly damaging 0.706 0.145 phenotype 06/30/2014
22 211133 UTSW Fbxl18 0.070 R1875 G1 225 Y 5 142886223 A419V G A missense Het probably damaging 0.959 0.217 phenotype 06/30/2014
23 211154 UTSW Fli1 0.648 R1875 G1 225 Y 9 32423913 M408V T C missense Het probably benign 0.032 0.085 phenotype 06/30/2014
24 211113 UTSW Fmo4 0.107 R1875 G1 225 Y 1 162803618 N260S T C missense Het possibly damaging 0.946 0.107 phenotype 06/30/2014
25 211134 UTSW Fry 0.666 R1875 G1 225 Y 5 150326132 E136G A G missense Het probably damaging 1.000 0.256 06/30/2014
26 211194 UTSW Gm10477 0.091 R1875 G1 222 Y X 56524767 F9Y T A missense Het probably damaging 0.998 0.430 06/30/2014
27 211132 UTSW Gm8258 0.224 R1875 G1 225 Y 5 104776454 A G exon Het noncoding transcript 0.125 06/30/2014
28 211172 UTSW Gpr68 0.000 R1875 G1 225 Y 12 100878790 D165V T A missense Het probably damaging 1.000 0.273 phenotype 06/30/2014
29 211130 UTSW Htt 1.000 R1875 G1 225 Y 5 34794112 M139K T A missense Het probably benign 0.050 0.482 phenotype 06/30/2014
30 211169 UTSW Jup 1.000 R1875 G1 113 N 11 100372294 A G splice site 2 bp Het probably null phenotype 06/30/2014
31 211185 UTSW Kifc5b 0.314 R1875 G1 89 N 17 26917290 G A splice site 5 bp Het probably null 06/30/2014
32 211135 UTSW Krba1 0.068 R1875 G1 225 Y 6 48414049 T A splice site Het probably null 0.976 06/30/2014
33 211148 UTSW Lamp1 0.000 R1875 G1 225 Y 8 13167257 G89R G A missense Het probably damaging 0.997 0.673 phenotype 06/30/2014
34 211121 UTSW Lexm 0.059 R1875 G1 225 Y 4 106613256 G A splice site Het probably benign phenotype 06/30/2014
35 211128 UTSW Lrrc17 0.000 R1875 G1 225 Y 5 21560652 S44F C T missense Het possibly damaging 0.847 0.095 phenotype 06/30/2014
36 211186 UTSW Mdga1 0.211 R1875 G1 142 Y 17 29852607 T347A T C missense Het probably damaging 0.995 0.155 phenotype 06/30/2014
37 211138 UTSW Mical3 0.205 R1875 G1 225 Y 6 121042064 W66R A T missense Het probably damaging 1.000 0.829 06/30/2014
38 211123 UTSW Mpl 0.000 R1875 G1 225 Y 4 118456829 Y73H A G missense Het probably benign 0.000 0.090 phenotype 06/30/2014
39 211126 UTSW Mterf1b 0.246 R1875 G1 225 Y 5 4197364 I335N T A missense Het possibly damaging 0.956 0.179 phenotype 06/30/2014
40 211152 UTSW Mylk3 0.214 R1875 G1 225 Y 8 85352865 I388T A G missense Het probably damaging 0.999 0.405 phenotype 06/30/2014
41 211166 UTSW Myo15 0.000 R1875 G1 147 Y 11 60507528 R2775W C T missense Het probably damaging 0.988 0.647 phenotype 06/30/2014
42 211119 UTSW Myoz2 0.090 R1875 G1 225 Y 3 123026116 S65T A T missense Het probably damaging 1.000 0.153 phenotype 06/30/2014
43 211179 UTSW Ndrg1 0.000 R1875 G1 225 Y 15 66931091 T137A T C missense Het possibly damaging 0.911 0.437 phenotype 06/30/2014
44 211151 UTSW Neil3 0.559 R1875 G1 225 Y 8 53599419 N381K G T missense Het probably damaging 1.000 0.336 phenotype 06/30/2014
45 211110 UTSW Obsl1 0.262 R1875 G1 225 Y 1 75498233 Y841C T C missense Het probably damaging 1.000 0.572 06/30/2014
46 211189 UTSW Olfr124 0.061 R1875 G1 225 Y 17 37805105 A G start gained Het probably benign phenotype 06/30/2014
47 211142 UTSW Olfr711 0.056 R1875 G1 225 Y 7 106972182 S54F G A missense Het possibly damaging 0.864 0.375 phenotype 06/30/2014
48 211160 UTSW Otogl 0.000 R1875 G1 225 Y 10 107899590 D111G T C missense Het probably damaging 1.000 0.332 phenotype 06/30/2014
49 211180 UTSW Parp10 0.143 R1875 G1 223 Y 15 76242851 E103G T C missense Het probably damaging 1.000 0.082 phenotype 06/30/2014
50 211122 UTSW Pars2 0.872 R1875 G1 225 Y 4 106653716 F232L T C missense Het possibly damaging 0.750 0.098 phenotype 06/30/2014
51 211116 UTSW Pcdh18 0.000 R1875 G1 225 Y 3 49754705 F720L A T missense Het probably damaging 0.985 0.192 phenotype 06/30/2014
52 211108 UTSW Phf3 0.000 R1875 G1 225 Y 1 30830623 E448G T C missense Het possibly damaging 0.805 0.061 phenotype 06/30/2014
53 211112 UTSW Pigc 0.000 R1875 G1 225 Y 1 161970947 Y166C A G missense Het probably damaging 0.988 0.812 phenotype 06/30/2014
54 211144 UTSW Pik3c2a 1.000 R1875 G1 225 Y 7 116417971 S184T A T missense Het probably benign 0.349 0.090 phenotype 06/30/2014
55 211162 UTSW Pkd1l1 1.000 R1875 G1 225 Y 11 8844670 A G splice site Het probably benign 0.090 phenotype 06/30/2014
56 211125 UTSW Plch2 0.000 R1875 G1 217 Y 4 154998508 S485F G A missense Het probably damaging 1.000 0.175 phenotype 06/30/2014
57 211136 UTSW Plxnd1 1.000 R1875 G1 194 Y 6 115978084 G T splice site Het probably null 0.976 phenotype 06/30/2014
58 211193 UTSW Pnliprp2 0.112 R1875 G1 225 Y 19 58763389 V189L G T missense Het probably benign 0.003 0.090 phenotype 06/30/2014
59 211174 UTSW Prl8a2 0.072 R1875 G1 225 Y 13 27351054 V103A T C missense Het probably benign 0.016 0.090 phenotype 06/30/2014
60 211140 UTSW Psg23 0.000 R1875 G1 225 Y 7 18610450 T360I G A missense Het probably benign 0.103 0.090 phenotype 06/30/2014
61 211168 UTSW Rad51c 1.000 R1875 G1 225 Y 11 87388643 I323N A T missense Het probably damaging 0.993 0.763 phenotype 06/30/2014
62 211127 UTSW Rsbn1l 0.169 R1875 G1 175 Y 5 20951698 E30K C T missense Het probably benign 0.172 0.090 06/30/2014
63 211173 UTSW Serpina3c 0.000 R1875 G1 225 Y 12 104151886 L64F C A missense Het probably damaging 0.999 0.647 06/30/2014
64 211164 UTSW Shroom1 0.139 R1875 G1 225 Y 11 53465675 D392G A G missense Het probably damaging 0.991 0.647 phenotype 06/30/2014
65 211129 UTSW Slc26a5 0.000 R1875 G1 225 Y 5 21815727 I540L T A missense Het probably benign 0.031 0.082 phenotype 06/30/2014
66 211155 UTSW Slc37a4 1.000 R1875 G1 225 Y 9 44401511 T321A A G missense Het probably damaging 0.980 0.164 phenotype 06/30/2014
67 211159 UTSW Slc41a2 0.247 R1875 G1 225 Y 10 83256085 L438S A G missense Het probably damaging 0.998 0.115 06/30/2014
68 211176 UTSW Spef2 0.102 R1875 G1 225 Y 15 9584108 E1624K C T missense Het probably damaging 0.957 0.289 phenotype 06/30/2014
69 211177 UTSW Spef2 0.102 R1875 G1 225 Y 15 9597401 G1390R C T missense Het possibly damaging 0.782 0.264 phenotype 06/30/2014
70 211184 UTSW Synj2 0.156 R1875 G1 225 Y 17 6028550 A740S G T missense Het possibly damaging 0.690 0.082 phenotype 06/30/2014
71 211131 UTSW Thegl 0.063 R1875 G1 225 Y 5 77054584 K284M A T missense Het probably benign 0.292 0.090 06/30/2014
72 211118 UTSW Tigd4 0.141 R1875 G1 225 Y 3 84595087 D437A A C missense Het probably benign 0.001 0.063 phenotype 06/30/2014
73 211191 UTSW Timm21 0.000 R1875 G1 225 Y 18 84949262 L130V G C missense Het probably damaging 1.000 0.767 06/30/2014
74 211170 UTSW Tmem106a 0.114 R1875 G1 101 Y 11 101586378 CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA unclassified Het probably benign 06/30/2014
75 211117 UTSW Tmem131l 0.126 R1875 G1 219 Y 3 83905076 C1313* A T nonsense Het probably null 0.964 06/30/2014
76 211139 UTSW Tmem86b 0.000 R1875 G1 225 Y 7 4629699 I47N A T missense Het possibly damaging 0.940 0.179 06/30/2014
77 211171 UTSW Tspan13 0.104 R1875 G1 225 Y 12 36020551 T C splice site 1261 bp Het probably null 0.095 phenotype 06/30/2014
78 211163 UTSW Vps54 0.928 R1875 G1 225 Y 11 21300251 T396A A G missense Het probably benign 0.001 0.059 phenotype 06/30/2014
79 211114 UTSW Zfp106 0.000 R1875 G1 225 Y 2 120513615 A T critical splice donor site 2 bp Het probably null 0.958 phenotype 06/30/2014
80 211147 UTSW Zfp668 0.118 R1875 G1 193 Y 7 127866482 T C splice site 1559 bp Het probably null 0.159 06/30/2014
81 211153 UTSW Zfp809 0.147 R1875 G1 225 Y 9 22238731 R175* A T nonsense Het probably null 0.976 phenotype 06/30/2014
[records 1 to 81 of 81]