Incidental Mutations

87 incidental mutations are currently displayed, and affect 87 genes.
16 are Possibly Damaging.
33 are Probably Damaging.
23 are Probably Benign.
14 are Probably Null.
5 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 87 of 87] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 209837 UTSW 4930579C12Rik 0.064 R1889 G1 225 Y 9 89152762 A G splice site Het noncoding transcript 06/30/2014
2 209866 UTSW 9130008F23Rik 0.051 R1889 G1 225 Y 17 40880302 R79G T C missense Het probably damaging 1.000 0.308 06/30/2014
3 209805 UTSW Aco1 0.289 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably null 0.950 phenotype 06/30/2014
4 209803 UTSW Acp6 0.137 R1889 G1 225 Y 3 97165885 R81W C T missense Het probably damaging 0.981 0.647 phenotype 06/30/2014
5 209824 UTSW Agbl1 0.000 R1889 G1 225 Y 7 76589381 Y543S A C missense Het probably damaging 0.995 0.148 phenotype 06/30/2014
6 209813 UTSW Anapc7 0.964 R1889 G1 225 Y 5 122433476 W205R T C missense Het probably damaging 1.000 0.812 phenotype 06/30/2014
7 209851 UTSW Ap1g2 0.407 R1889 G1 165 Y 14 55101429 M532L T A missense Het probably damaging 0.997 0.117 phenotype 06/30/2014
8 209850 UTSW Appl1 0.280 R1889 G1 225 Y 14 26925513 A G splice site Het probably benign phenotype 06/30/2014
9 209806 UTSW Arhgef19 0.301 R1889 G1 201 Y 4 141249313 F462S T C missense Het probably damaging 1.000 0.777 phenotype 06/30/2014
10 265989 UTSW Astn1 0.102 R1889 G1 225 N 1 158505316 A G splice site Het probably null phenotype 02/05/2015
11 209873 UTSW AU015836 0.363 R1889 G1 222 Y X 93969379 T C utr 5 prime Het probably benign 0.090 06/30/2014
12 209820 UTSW Cacna1c 0.251 R1889 G1 225 Y 6 118612625 R1446H C T missense Het probably damaging 1.000 0.647 phenotype 06/30/2014
13 209862 UTSW Cadm2 0.687 R1889 G1 225 Y 16 66882795 D50G T C missense Het probably damaging 1.000 0.446 phenotype 06/30/2014
14 209826 UTSW Ccdc81 0.109 R1889 G1 225 Y 7 89882294 Q324* G A nonsense Het probably null 0.976 06/30/2014
15 209845 UTSW Cd300lf 0.074 R1889 G1 225 Y 11 115120380 V178A A G missense Het probably benign 0.006 0.090 phenotype 06/30/2014
16 209833 UTSW Cdt1 0.967 R1889 G1 110 Y 8 122572052 V476A T C missense Het possibly damaging 0.845 0.530 phenotype 06/30/2014
17 209852 UTSW Cenpj 1.000 R1889 G1 225 Y 14 56558725 V225A A G missense Het probably benign 0.433 0.090 phenotype 06/30/2014
18 209834 UTSW Cep295 0.950 R1889 G1 225 Y 9 15332103 T1686A T C missense Het possibly damaging 0.944 0.077 06/30/2014
19 209840 UTSW Cfap54 0.077 R1889 G1 225 Y 10 93034710 S684P A G missense Het possibly damaging 0.939 0.095 phenotype 06/30/2014
20 209814 UTSW Clip1 0.000 R1889 G1 225 Y 5 123653496 V204F C A missense Het probably damaging 0.994 0.647 phenotype 06/30/2014
21 209815 UTSW Cnpy4 0.107 R1889 G1 225 Y 5 138192840 E226G A G missense Het probably benign 0.064 0.084 phenotype 06/30/2014
22 209786 UTSW Col6a3 0.000 R1889 G1 225 Y 1 90803711 M1000L T A missense Het probably benign 0.005 0.061 phenotype 06/30/2014
23 209857 UTSW Cpsf1 0.971 R1889 G1 225 Y 15 76602156 M335V T C missense Het probably benign 0.065 0.100 phenotype 06/30/2014
24 209798 UTSW Dnmt3b 1.000 R1889 G1 225 Y 2 153676759 A614E C A missense Het probably benign 0.000 0.090 phenotype 06/30/2014
25 209800 UTSW Dpm1 1.000 R1889 G1 225 Y 2 168217735 R147Q C T missense Het possibly damaging 0.669 0.179 phenotype 06/30/2014
26 265990 UTSW Dpp7 0.098 R1889 G1 225 N 2 25353679 G T splice site Het probably null phenotype 02/05/2015
27 209846 UTSW Engase 0.074 R1889 G1 225 Y 11 118478933 F57S T C missense Het probably damaging 0.998 0.087 phenotype 06/30/2014
28 209789 UTSW Epb41l5 1.000 R1889 G1 225 Y 1 119549172 D718G T C missense Het possibly damaging 0.816 0.179 phenotype 06/30/2014
29 209844 UTSW Fam20a 0.000 R1889 G1 225 Y 11 109673554 K458E T C missense Het probably benign 0.296 0.392 phenotype 06/30/2014
30 209807 UTSW Fbxo44 0.000 R1889 G1 225 Y 4 148156269 R220S C G missense Het probably damaging 1.000 0.681 phenotype 06/30/2014
31 209818 UTSW Gkn2 0.000 R1889 G1 225 Y 6 87378155 Y115* T A nonsense Het probably null 0.976 phenotype 06/30/2014
32 209793 UTSW Gtdc1 0.088 R1889 G1 225 Y 2 44591914 S246P A G missense Het probably damaging 1.000 0.432 06/30/2014
33 209865 UTSW H2-Q2 0.073 R1889 G1 225 Y 17 35345176 D302G A G missense Het probably benign 0.237 0.090 06/30/2014
34 209823 UTSW Herc2 0.944 R1889 G1 225 Y 7 56189813 S3357L C T missense Het possibly damaging 0.603 0.156 phenotype 06/30/2014
35 209817 UTSW Herc6 0.000 R1889 G1 225 Y 6 57662075 Y840* T A nonsense Het probably null 0.976 phenotype 06/30/2014
36 209816 UTSW Hoxa10 0.000 R1889 G1 105 Y 6 52234492 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 06/30/2014
37 209819 UTSW Ift122 1.000 R1889 G1 119 Y 6 115894421 T C critical splice donor site 2 bp Het probably null 0.950 phenotype 06/30/2014
38 209835 UTSW Ilf3 1.000 R1889 G1 174 Y 9 21404767 T A unclassified Het probably benign 0.070 phenotype 06/30/2014
39 209839 UTSW Itgb2 0.280 R1889 G1 225 Y 10 77548623 N193Y A T missense Het possibly damaging 0.744 0.142 phenotype 06/30/2014
40 209859 UTSW Itgb5 0.000 R1889 G1 225 Y 16 33910469 I65S T G missense Het probably damaging 1.000 0.906 phenotype 06/30/2014
41 209863 UTSW Jpt2 0.096 R1889 G1 91 Y 17 24960611 M1V T C start codon destroyed Het probably null 0.706 0.952 06/30/2014
42 209790 UTSW Kcnt2 0.105 R1889 G1 225 Y 1 140584293 H995L A T missense Het probably damaging 0.999 0.174 phenotype 06/30/2014
43 209871 UTSW Kif20b 0.847 R1889 G1 225 Y 19 34941208 T C unclassified Het probably benign 0.090 phenotype 06/30/2014
44 209825 UTSW Kif7 1.000 R1889 G1 225 Y 7 79710463 Y342C T C missense Het probably damaging 1.000 0.664 phenotype 06/30/2014
45 209808 UTSW Klhl21 0.123 R1889 G1 87 Y 4 152015420 V529A T C missense Het possibly damaging 0.908 0.155 06/30/2014
46 258026 UTSW Klhl26 0.000 R1889 G1 72 Y 8 70451733 D475G T C missense Het probably damaging 0.989 0.107 01/14/2015
47 209872 UTSW Lcor 0.851 R1889 G1 225 Y 19 41559128 Y384H T C missense Het probably damaging 0.994 0.712 phenotype 06/30/2014
48 209792 UTSW Lrp1b 0.000 R1889 G1 225 Y 2 40919167 C2463* A T nonsense Het probably null 0.976 phenotype 06/30/2014
49 209854 UTSW March6 0.433 R1889 G1 225 Y 15 31459193 E909G T C missense Het possibly damaging 0.855 0.195 phenotype 06/30/2014
50 209791 UTSW Mrc1 0.092 R1889 G1 225 Y 2 14308677 A T critical splice acceptor site Het probably null 0.949 phenotype 06/30/2014
51 209842 UTSW Nipal4 0.116 R1889 G1 225 Y 11 46150733 I212F T A missense Het probably damaging 0.994 0.251 phenotype 06/30/2014
52 209827 UTSW Nup98 1.000 R1889 G1 225 Y 7 102160716 T536S T A missense Het probably damaging 0.999 0.095 phenotype 06/30/2014
53 209811 UTSW Nwd2 0.107 R1889 G1 225 Y 5 63807666 E1531G A G missense Het possibly damaging 0.491 0.193 06/30/2014
54 209836 UTSW Nxpe2 0.082 R1889 G1 225 Y 9 48326614 T114A T C missense Het probably damaging 0.994 0.248 06/30/2014
55 209861 UTSW Olfr204 0.120 R1889 G1 225 Y 16 59314963 Y148S T G missense Het probably damaging 0.983 0.264 phenotype 06/30/2014
56 209870 UTSW Oosp1 0.085 R1889 G1 225 Y 19 11667794 V169I C T missense Het possibly damaging 0.455 0.179 06/30/2014
57 209858 UTSW Opa1 1.000 R1889 G1 225 Y 16 29625585 V863A T C missense Het possibly damaging 0.674 0.104 phenotype 06/30/2014
58 209802 UTSW Pabpc4l 0.000 R1889 G1 225 Y 3 46446363 M282K A T missense Het probably benign 0.001 0.090 06/30/2014
59 209860 UTSW Parp14 0.387 R1889 G1 225 Y 16 35856760 A946V G A missense Het probably benign 0.089 0.090 phenotype 06/30/2014
60 209869 UTSW Pcnx3 0.000 R1889 G1 225 Y 19 5672656 D1336G T C missense Het probably damaging 1.000 0.265 06/30/2014
61 209787 UTSW Phlpp1 0.151 R1889 G1 225 Y 1 106318850 V590A T C missense Het possibly damaging 0.948 0.108 phenotype 06/30/2014
62 209797 UTSW Rbck1 0.000 R1889 G1 163 Y 2 152318356 T468S T A missense Het probably damaging 0.989 0.294 phenotype 06/30/2014
63 209848 UTSW Ripor2 0.178 R1889 G1 225 Y 13 24693887 I290N T A missense Het probably damaging 1.000 0.908 phenotype 06/30/2014
64 209855 UTSW Rnf139 0.206 R1889 G1 225 Y 15 58899497 L457P T C missense Het probably damaging 1.000 0.912 phenotype 06/30/2014
65 209847 UTSW Rtn1 0.000 R1889 G1 225 Y 12 72304410 A342S C A missense Het possibly damaging 0.873 0.114 phenotype 06/30/2014
66 209810 UTSW Sema3d 0.181 R1889 G1 225 Y 5 12485021 A G splice site 4 bp Het probably null 0.976 phenotype 06/30/2014
67 209788 UTSW Serpinb2 0.000 R1889 G1 225 Y 1 107524607 V305D T A missense Het probably damaging 1.000 0.612 phenotype 06/30/2014
68 209828 UTSW Sez6l2 0.000 R1889 G1 225 Y 7 126953496 V148A T C missense Het probably damaging 0.999 0.447 phenotype 06/30/2014
69 209831 UTSW Shank2 0.000 R1889 G1 225 Y 7 144186858 S568* C A nonsense Het probably null 0.970 phenotype 06/30/2014
70 209849 UTSW Skiv2l2 0.966 R1889 G1 191 Y 13 112887490 N707S T C missense Het probably benign 0.001 0.057 06/30/2014
71 209812 UTSW Slc10a4 0.000 R1889 G1 225 Y 5 73012147 S372P T C missense Het possibly damaging 0.909 0.113 phenotype 06/30/2014
72 209801 UTSW Slc10a5 0.153 R1889 G1 225 Y 3 10335490 T37A T C missense Het probably benign 0.329 0.129 06/30/2014
73 209868 UTSW Slc14a1 0.000 R1889 G1 225 Y 18 78109697 I276V T C missense Het possibly damaging 0.950 0.550 phenotype 06/30/2014
74 209838 UTSW Slc6a20b 0.000 R1889 G1 199 Y 9 123632204 D52E G T missense Het probably benign 0.021 0.090 06/30/2014
75 209822 UTSW Slc6a5 1.000 R1889 G1 225 Y 7 49951434 M661T T C missense Het probably benign 0.027 0.171 phenotype 06/30/2014
76 209843 UTSW Ssh2 0.323 R1889 G1 225 Y 11 77449745 D574E C G missense Het probably damaging 0.999 0.073 phenotype 06/30/2014
77 209809 UTSW Steap4 0.107 R1889 G1 225 Y 5 7975892 R151L G T missense Het probably damaging 0.999 0.259 phenotype 06/30/2014
78 209799 UTSW Sun5 0.000 R1889 G1 225 Y 2 153865995 I107L T A missense Het probably benign 0.112 0.127 06/30/2014
79 209832 UTSW Tacc1 0.268 R1889 G1 225 Y 8 25175253 V488M C T missense Het probably damaging 0.988 0.077 phenotype 06/30/2014
80 209804 UTSW Tgs1 1.000 R1889 G1 225 Y 4 3614928 T829A A G missense Het probably benign 0.306 0.111 phenotype 06/30/2014
81 209864 UTSW Tnxb 0.000 R1889 G1 225 Y 17 34695825 E1929G A G missense Het probably damaging 0.971 0.390 phenotype 06/30/2014
82 209829 UTSW Tssc4 0.064 R1889 G1 225 Y 7 143070555 Q200P A C missense Het probably damaging 0.999 0.398 phenotype 06/30/2014
83 209794 UTSW Ttn 1.000 R1889 G1 225 Y 2 76758532 W21398R A G missense Het probably damaging 1.000 0.369 phenotype 06/30/2014
84 209796 UTSW Usp50 1.000 R1889 G1 225 Y 2 126777898 C T critical splice donor site 1 bp Het probably null 0.948 06/30/2014
85 265991 UTSW Usp9y 0.064 R1889 G1 222 N Y 1448829 A T splice site 22 bp Het probably null phenotype 02/05/2015
86 209821 UTSW V1rd19 0.066 R1889 G1 225 Y 7 24003207 F33I T A missense Het probably benign 0.062 0.090 06/30/2014
87 209856 UTSW Zfat 1.000 R1889 G1 225 Y 15 68101539 T1118A T C missense Het probably benign 0.003 0.074 phenotype 06/30/2014
[records 1 to 87 of 87]