Incidental Mutations

86 incidental mutations are currently displayed, and affect 86 genes.
12 are Possibly Damaging.
36 are Probably Damaging.
22 are Probably Benign.
12 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 86 of 86] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 213832 UTSW 1700020L24Rik 0.715 R1939 G1 119 N 11 83440304 W11R T A missense Het probably damaging 0.999 07/14/2014
2 213839 UTSW 2700049A03Rik 1.000 R1939 G1 225 N 12 71160412 A G splice site 4 bp Het probably null phenotype 07/14/2014
3 213860 UTSW 3110002H16Rik 0.729 R1939 G1 225 N 18 12180505 L15P T C missense Het probably damaging 0.997 phenotype 07/14/2014
4 213781 UTSW 4933409G03Rik 0.069 R1939 G1 225 N 2 68588984 S26P T C missense Het possibly damaging 0.827 07/14/2014
5 213863 UTSW 9930021J03Rik 0.133 R1939 G1 225 N 19 29753677 F712S A G missense Het possibly damaging 0.869 0.138 07/14/2014
6 213866 UTSW Ace2 0.416 R1939 G1 222 N X 164156528 M123L A T missense Het possibly damaging 0.707 0.693 phenotype 07/14/2014
7 213840 UTSW Acot3 0.075 R1939 G1 225 N 12 84058551 N264S A G missense Het probably benign 0.000 07/14/2014
8 213780 UTSW Acvr1c 0.000 R1939 G1 225 N 2 58283505 N248K A T missense Het probably damaging 1.000 0.935 phenotype 07/14/2014
9 213800 UTSW Adam22 1.000 R1939 G1 225 N 5 8330015 F94L A T missense Het probably damaging 0.997 phenotype 07/14/2014
10 213842 UTSW Adarb2 0.000 R1939 G1 181 N 13 8203322 T C critical splice donor site 2 bp Het probably null phenotype 07/14/2014
11 213796 UTSW Aldh1b1 0.000 R1939 G1 225 N 4 45802755 M98V A G missense Het possibly damaging 0.532 phenotype 07/14/2014
12 213789 UTSW Arfgef2 0.448 R1939 G1 225 N 2 166873628 V1331D T A missense Het probably damaging 0.997 phenotype 07/14/2014
13 213783 UTSW Atf2 0.946 R1939 G1 225 N 2 73846219 P184S G A missense Het probably damaging 1.000 0.119 phenotype 07/14/2014
14 213825 UTSW Atp8b3 0.073 R1939 G1 181 N 10 80525386 C785* A T nonsense Het probably null phenotype 07/14/2014
15 213859 UTSW Birc6 1.000 R1939 G1 143 N 17 74670337 S4362P T C missense Het probably damaging 0.999 phenotype 07/14/2014
16 213782 UTSW Chn1 0.348 R1939 G1 225 N 2 73624901 C39R A G missense Het probably damaging 1.000 0.968 phenotype 07/14/2014
17 213816 UTSW Cngb1 1.000 R1939 G1 195 N 8 95299692 G154W C A missense Het probably damaging 1.000 0.647 phenotype 07/14/2014
18 213773 UTSW Cntnap5b 0.089 R1939 G1 225 N 1 99967348 H115R A G missense Het probably benign 0.000 07/14/2014
19 213831 UTSW Col23a1 0.066 R1939 G1 225 N 11 51551989 D159G A G missense Het unknown phenotype 07/14/2014
20 213853 UTSW Coro7 0.100 R1939 G1 225 N 16 4628732 E843G T C missense Het probably benign 0.000 0.090 phenotype 07/14/2014
21 213814 UTSW Dnase2a 1.000 R1939 G1 225 N 8 84910895 A309S G T missense Het possibly damaging 0.830 phenotype 07/14/2014
22 213820 UTSW Dync2h1 1.000 R1939 G1 225 N 9 7139159 A G critical splice donor site 2 bp Het probably null phenotype 07/14/2014
23 213835 UTSW Engase 0.070 R1939 G1 225 N 11 118479186 N97K T A missense Het probably damaging 0.998 phenotype 07/14/2014
24 213823 UTSW Fam83b 0.085 R1939 G1 225 N 9 76493080 M247K A T missense Het probably damaging 0.999 07/14/2014
25 213857 UTSW Fer 0.000 R1939 G1 225 N 17 63973128 S65P T C missense Het probably damaging 1.000 phenotype 07/14/2014
26 213847 UTSW Fgf10 1.000 R1939 G1 225 N 13 118789152 R156G A G missense Het probably damaging 1.000 phenotype 07/14/2014
27 213824 UTSW Gm10608 0.082 R1939 G1 202 N 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA frame shift Het probably null 07/14/2014
28 213771 UTSW Gm5415 0.210 R1939 G1 225 N 1 32545546 I428V T C missense Het probably damaging 0.992 07/14/2014
29 213846 UTSW Gm904 0.071 R1939 G1 225 N 13 50644736 T C critical splice donor site 2 bp Het probably null 07/14/2014
30 213784 UTSW Gpat2 0.000 R1939 G1 225 N 2 127435959 *802K T A makesense Het probably null 07/14/2014
31 213826 UTSW Hcfc2 0.282 R1939 G1 225 N 10 82702450 R107L G T missense Het probably damaging 0.994 phenotype 07/14/2014
32 213777 UTSW Itga8 0.805 R1939 G1 225 N 2 12300846 D111A T G missense Het probably damaging 1.000 phenotype 07/14/2014
33 213785 UTSW Jag1 1.000 R1939 G1 225 N 2 137083473 V1070L C G missense Het possibly damaging 0.787 0.091 phenotype 07/14/2014
34 213790 UTSW Lama5 1.000 R1939 G1 225 N 2 180190921 N1646S T C missense Het probably benign 0.001 0.090 phenotype 07/14/2014
35 213843 UTSW Lgals8 0.159 R1939 G1 225 N 13 12459188 I10L T G missense Het probably benign 0.001 phenotype 07/14/2014
36 213779 UTSW Lrp1b 0.000 R1939 G1 225 N 2 40697589 S116P A G missense Het unknown phenotype 07/14/2014
37 213849 UTSW Mcpt1 0.120 R1939 G1 225 N 14 56019089 K94I A T missense Het possibly damaging 0.948 phenotype 07/14/2014
38 213856 UTSW Mpnd 0.154 R1939 G1 225 N 17 56015920 F384S T C missense Het probably damaging 0.998 07/14/2014
39 213810 UTSW Mrgprb5 0.054 R1939 G1 225 N 7 48168938 N16K A T missense Het probably benign 0.004 07/14/2014
40 213834 UTSW Myo15b 0.086 R1939 G1 225 N 11 115887703 T1139A A G missense Het probably benign 0.004 07/14/2014
41 213803 UTSW Nat8f5 0.000 R1939 G1 225 N 6 85817819 I53R A C missense Het possibly damaging 0.926 phenotype 07/14/2014
42 213775 UTSW Nav1 0.941 R1939 G1 225 N 1 135465898 L1034Q A T missense Het probably damaging 1.000 phenotype 07/14/2014
43 213791 UTSW Nudt6 0.267 R1939 G1 225 N 3 37405230 Y54C T C missense Het probably damaging 1.000 phenotype 07/14/2014
44 213776 UTSW Olfr1404 0.450 R1939 G1 225 N 1 173215932 A94S G T missense Het probably benign 0.004 phenotype 07/14/2014
45 213812 UTSW Olfr482 0.134 R1939 G1 225 N 7 108095141 V143A A G missense Het probably benign 0.065 phenotype 07/14/2014
46 213829 UTSW Olfr815 0.053 R1939 G1 225 N 10 129902101 M203R A C missense Het probably damaging 0.964 phenotype 07/14/2014
47 213821 UTSW Olfr881 0.066 R1939 G1 225 N 9 37993089 N199S A G missense Het probably benign 0.115 phenotype 07/14/2014
48 213822 UTSW Olfr893 0.070 R1939 G1 225 N 9 38209429 Y72* T A nonsense Het probably null phenotype 07/14/2014
49 213827 UTSW Osbpl8 0.230 R1939 G1 225 N 10 111289811 H784L A T missense Het probably benign 0.186 phenotype 07/14/2014
50 213837 UTSW Osr1 0.777 R1939 G1 225 N 12 9579687 S187A T G missense Het probably damaging 1.000 phenotype 07/14/2014
51 213861 UTSW Pcdhgc5 0.709 R1939 G1 225 N 18 37821950 Y759C A G missense Het probably damaging 1.000 phenotype 07/14/2014
52 213819 UTSW Pkd1l2 0.000 R1939 G1 225 N 8 117046182 Y1035* G T nonsense Het probably null phenotype 07/14/2014
53 213818 UTSW Pla2g15 0.181 R1939 G1 225 N 8 106163295 T400A A G missense Het probably damaging 0.960 phenotype 07/14/2014
54 213772 UTSW Pms1 0.000 R1939 G1 225 N 1 53196976 L715R A C missense Het probably damaging 0.999 phenotype 07/14/2014
55 213838 UTSW Prkd1 1.000 R1939 G1 225 N 12 50394994 N254S T C missense Het probably benign 0.003 phenotype 07/14/2014
56 213854 UTSW Prkdc 0.962 R1939 G1 225 N 16 15835913 V3868A T C missense Het possibly damaging 0.948 phenotype 07/14/2014
57 213787 UTSW Ptprt 0.129 R1939 G1 225 N 2 161927640 N435S T C missense Het probably benign 0.450 phenotype 07/14/2014
58 213830 UTSW Purb 0.404 R1939 G1 225 N 11 6474943 E315G T C missense Het unknown phenotype 07/14/2014
59 213828 UTSW Rap1b 0.503 R1939 G1 225 N 10 117818586 N116K A T missense Het probably damaging 1.000 phenotype 07/14/2014
60 213851 UTSW Rp1l1 0.082 R1939 G1 225 N 14 64029593 N876S A G missense Het probably benign 0.000 phenotype 07/14/2014
61 213862 UTSW Rps6ka4 0.887 R1939 G1 225 N 19 6839466 I114F T A missense Het probably damaging 1.000 phenotype 07/14/2014
62 213801 UTSW Sh3bp2 0.000 R1939 G1 225 N 5 34551619 N19D A G missense Het probably damaging 1.000 phenotype 07/14/2014
63 213794 UTSW Slc16a4 0.000 R1939 G1 225 N 3 107301001 M276V A G missense Het probably benign 0.002 07/14/2014
64 213844 UTSW Slc17a1 0.057 R1939 G1 225 N 13 23875881 T172A A G missense Het probably benign 0.051 07/14/2014
65 213848 UTSW Slc4a7 0.913 R1939 G1 225 N 14 14748581 A320V C T missense Het probably damaging 1.000 phenotype 07/14/2014
66 213806 UTSW Slco1a6 0.060 R1939 G1 225 N 6 142133230 Y113F T A missense Het probably damaging 1.000 07/14/2014
67 213788 UTSW Srsf6 0.807 R1939 G1 225 N 2 162934483 C T unclassified Het probably benign 0.160 phenotype 07/14/2014
68 213855 UTSW St3gal6 0.153 R1939 G1 225 N 16 58473561 A T splice site Het probably null phenotype 07/14/2014
69 213845 UTSW Tdp2 0.751 R1939 G1 225 N 13 24841277 D343G A G missense Het probably benign 0.072 phenotype 07/14/2014
70 213841 UTSW Tecpr2 0.000 R1939 G1 225 N 12 110933169 L657Q T A missense Het probably damaging 0.979 phenotype 07/14/2014
71 213795 UTSW Tet2 1.000 R1939 G1 225 N 3 133488638 T12A T C missense Het possibly damaging 0.682 0.179 phenotype 07/14/2014
72 213807 UTSW Trappc6a 0.000 R1939 G1 225 N 7 19514501 F28I T A missense Het probably damaging 1.000 phenotype 07/14/2014
73 213797 UTSW Trim32 0.781 R1939 G1 225 N 4 65614066 V287I G A missense Het probably benign 0.000 phenotype 07/14/2014
74 213864 UTSW Trpd52l3 0.067 R1939 G1 225 N 19 30003889 S15P T C missense Het probably damaging 0.998 phenotype 07/14/2014
75 213817 UTSW Tsnaxip1 0.602 R1939 G1 225 N 8 105840038 I169V A G missense Het probably benign 0.035 07/14/2014
76 213799 UTSW Ttc34 0.203 R1939 G1 225 N 4 154865682 A1031T G A missense Het possibly damaging 0.804 0.242 07/14/2014
77 213778 UTSW Ttll11 0.000 R1939 G1 225 N 2 35940753 Q18L T A missense Het probably null 07/14/2014
78 213852 UTSW Ttll8 0.293 R1939 G1 225 N 15 88915486 I584N A T missense Het probably damaging 1.000 07/14/2014
79 213798 UTSW Ubiad1 1.000 R1939 G1 225 N 4 148444011 L147P A G missense Het probably damaging 1.000 0.956 phenotype 07/14/2014
80 213811 UTSW Ucp3 0.077 R1939 G1 225 N 7 100480664 V171A T C missense Het probably benign 0.004 phenotype 07/14/2014
81 213808 UTSW Vmn1r174 0.062 R1939 G1 225 N 7 23754107 I66N T A missense Het probably damaging 0.987 07/14/2014
82 213802 UTSW Vmn2r13 0.106 R1939 G1 225 N 5 109191986 D41G T C missense Het possibly damaging 0.883 07/14/2014
83 213792 UTSW Vmn2r4 0.070 R1939 G1 225 N 3 64398555 D393G T C missense Het probably benign 0.005 07/14/2014
84 213833 UTSW Wipf2 0.288 R1939 G1 225 N 11 98892410 R221* C T nonsense Het probably null 0.976 phenotype 07/14/2014
85 213809 UTSW Zfp976 0.099 R1939 G1 225 N 7 42613681 C244F C A missense Het unknown 07/14/2014
86 213850 UTSW Zmym5 0.387 R1939 G1 225 N 14 56799120 V190A A G missense Het probably damaging 0.983 07/14/2014
[records 1 to 86 of 86]