Incidental Mutations

108 incidental mutations are currently displayed, and affect 108 genes.
16 are Possibly Damaging.
30 are Probably Damaging.
48 are Probably Benign.
13 are Probably Null.
5 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 108] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 213963 UTSW 2410089E03Rik 1.000 R1940 G1 225 Y 15 8233852 S2496R T A missense Het probably damaging 0.979 0.102 phenotype 07/14/2014
2 213927 UTSW Abca16 0.000 R1940 G1 225 Y 7 120433609 T C splice site Het probably benign 07/14/2014
3 213983 UTSW Ace2 0.288 R1940 G1 222 Y X 164156528 M123L A T missense Het possibly damaging 0.707 0.693 phenotype 07/14/2014
4 213882 UTSW Acvr1c 0.000 R1940 G1 225 Y 2 58283505 N248K A T missense Het probably damaging 1.000 0.935 phenotype 07/14/2014
5 213928 UTSW Adam24 0.116 R1940 G1 225 Y 8 40681361 R623* A T nonsense Het probably null 0.976 phenotype 07/14/2014
6 213888 UTSW Agbl2 0.000 R1940 G1 225 Y 2 90811282 L752Q T A missense Het probably damaging 0.994 0.079 phenotype 07/14/2014
7 213923 UTSW Ankrd26 0.000 R1940 G1 225 Y 6 118511693 F1335Y A T missense Het probably damaging 0.995 0.147 phenotype 07/14/2014
8 213903 UTSW Ankrd34a 0.120 R1940 G1 225 Y 3 96598676 S399G A G missense Het probably benign 0.278 0.074 07/14/2014
9 213941 UTSW Ap3d1 0.932 R1940 G1 225 Y 10 80709773 P1041S G A missense Het probably benign 0.026 0.224 phenotype 07/14/2014
10 213935 UTSW Arid3b 1.000 R1940 G1 202 Y 9 57796148 M466K A T missense Het possibly damaging 0.861 0.288 phenotype 07/14/2014
11 213904 UTSW Arsj 0.058 R1940 G1 225 Y 3 126438346 I247T T C missense Het probably damaging 1.000 0.479 phenotype 07/14/2014
12 213975 UTSW AU016765 0.132 R1940 G1 225 Y 17 64519878 G A exon Het noncoding transcript 07/14/2014
13 213910 UTSW Azin2 0.282 R1940 G1 209 Y 4 128950784 C T splice site Het probably null 0.976 phenotype 07/14/2014
14 213925 UTSW Bcat2 0.193 R1940 G1 225 Y 7 45588368 Y313H T C missense Het possibly damaging 0.765 0.292 phenotype 07/14/2014
15 213898 UTSW Cables2 0.101 R1940 G1 225 Y 2 180260080 V465A A G missense Het probably damaging 0.973 07/14/2014
16 213918 UTSW Ccdc60 0.051 R1940 G1 225 Y 5 116126165 H517Y G A missense Het probably damaging 1.000 0.130 07/14/2014
17 213875 UTSW Cd55b 0.000 R1940 G1 225 Y 1 130418106 A T critical splice donor site 2 bp Het probably null 0.958 phenotype 07/14/2014
18 213939 UTSW Cdc40 0.960 R1940 G1 225 Y 10 40883071 G A unclassified Het probably benign 0.114 phenotype 07/14/2014
19 213872 UTSW Cdh7 0.000 R1940 G1 225 Y 1 110049024 V140I G A missense Het probably benign 0.089 0.071 phenotype 07/14/2014
20 213905 UTSW Cfi 0.000 R1940 G1 225 Y 3 129858828 T C splice site Het probably benign phenotype 07/14/2014
21 213876 UTSW Chit1 0.169 R1940 G1 225 Y 1 134145418 G A critical splice donor site 1 bp Het probably null 0.948 phenotype 07/14/2014
22 213884 UTSW Chn1 0.414 R1940 G1 225 Y 2 73624901 C39R A G missense Het probably damaging 1.000 0.968 phenotype 07/14/2014
23 213893 UTSW Ciao1 0.959 R1940 G1 225 Y 2 127246460 S148P A G missense Het possibly damaging 0.954 0.281 07/14/2014
24 213953 UTSW Clmn 0.000 R1940 G1 225 Y 12 104790102 T163I G A missense Het probably damaging 0.998 0.353 07/14/2014
25 213931 UTSW Cngb1 1.000 R1940 G1 213 Y 8 95299692 G154W C A missense Het probably damaging 1.000 0.647 phenotype 07/14/2014
26 213868 UTSW Col19a1 1.000 R1940 G1 225 Y 1 24264750 C1117* A T nonsense Het probably null 0.975 phenotype 07/14/2014
27 213965 UTSW Cyp2d10 0.265 R1940 G1 225 Y 15 82405294 I206F T A missense Het probably benign 0.132 0.090 07/14/2014
28 213894 UTSW Ddrgk1 1.000 R1940 G1 216 Y 2 130663560 G T splice site Het probably benign phenotype 07/14/2014
29 213874 UTSW Ddx18 0.967 R1940 G1 225 Y 1 121555224 V611D A T missense Het probably damaging 1.000 0.918 phenotype 07/14/2014
30 213973 UTSW Dnah8 0.483 R1940 G1 225 Y 17 30731207 H2000L A T missense Het probably damaging 0.998 0.553 phenotype 07/14/2014
31 213889 UTSW Duox1 0.000 R1940 G1 216 Y 2 122325984 V464A T C missense Het probably benign 0.065 0.353 phenotype 07/14/2014
32 213934 UTSW Dync2h1 1.000 R1940 G1 225 Y 9 7139159 A G critical splice donor site 2 bp Het probably null phenotype 07/14/2014
33 213943 UTSW Eif4enif1 0.420 R1940 G1 225 Y 11 3243279 H857R A G missense Het probably damaging 1.000 0.105 phenotype 07/14/2014
34 213896 UTSW Elmo2 0.367 R1940 G1 225 Y 2 165292050 A G unclassified Het probably benign 0.090 phenotype 07/14/2014
35 266001 UTSW Fam171b 0.101 R1940 G1 105 N 2 83812874 CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC small deletion Het probably benign 02/05/2015
36 213959 UTSW Glrx 0.182 R1940 G1 225 Y 13 75840137 I57V A G missense Het probably benign 0.258 0.186 phenotype 07/14/2014
37 213960 UTSW Gm281 0.062 R1940 G1 225 Y 14 13828582 M726K A T missense Het probably null 0.954 0.976 07/14/2014
38 213956 UTSW Golm1 0.069 R1940 G1 208 Y 13 59642237 A T splice site Het probably benign 0.090 phenotype 07/14/2014
39 213915 UTSW Grm3 0.000 R1940 G1 225 Y 5 9511682 R723W G A missense Het probably damaging 1.000 0.268 phenotype 07/14/2014
40 213867 UTSW Gsta3 0.160 R1940 G1 225 Y 1 21257377 R45Q G A missense Het probably benign 0.077 0.090 phenotype 07/14/2014
41 213870 UTSW Gtf3c3 0.962 R1940 G1 225 Y 1 54428958 A C splice site Het probably benign phenotype 07/14/2014
42 213954 UTSW Hk3 0.081 R1940 G1 212 Y 13 55011391 V451I C T missense Het probably damaging 0.984 0.333 phenotype 07/14/2014
43 213922 UTSW Hoxa10 0.000 R1940 G1 225 Y 6 52234370 G189C C A missense Het possibly damaging 0.867 0.179 phenotype 07/14/2014
44 213946 UTSW Hs3st3b1 0.000 R1940 G1 225 Y 11 63889743 D186G T C missense Het probably benign 0.015 0.063 phenotype 07/14/2014
45 213917 UTSW Hscb 0.955 R1940 G1 225 Y 5 110836060 H63N G T missense Het probably benign 0.000 0.090 phenotype 07/14/2014
46 213972 UTSW Itpr3 0.000 R1940 G1 225 Y 17 27111217 E1603G A G missense Het probably damaging 1.000 0.557 phenotype 07/14/2014
47 213902 UTSW Ivl 0.000 R1940 G1 225 Y 3 92572749 H3L T A missense Het probably benign 0.001 0.090 phenotype 07/14/2014
48 213929 UTSW Klhl26 0.000 R1940 G1 132 Y 8 70452261 R252L C A missense Het probably damaging 1.000 0.094 07/14/2014
49 213949 UTSW Krt31 0.000 R1940 G1 225 Y 11 100048243 T251S T A missense Het probably benign 0.034 0.192 07/14/2014
50 213897 UTSW Lama5 1.000 R1940 G1 225 Y 2 180190921 N1646S T C missense Het probably benign 0.001 0.090 phenotype 07/14/2014
51 213881 UTSW Lhx3 1.000 R1940 G1 225 Y 2 26203962 D83G T C missense Het probably benign 0.047 0.196 phenotype 07/14/2014
52 213940 UTSW Lss 1.000 R1940 G1 225 Y 10 76545462 N427K C A missense Het possibly damaging 0.953 0.473 phenotype 07/14/2014
53 213938 UTSW Mettl24 0.000 R1940 G1 211 Y 10 40737726 A154T G A missense Het probably benign 0.007 0.090 07/14/2014
54 213869 UTSW Mgat4a 0.317 R1940 G1 225 Y 1 37536037 A T critical splice donor site 2 bp Het probably null 0.958 phenotype 07/14/2014
55 213919 UTSW Moxd2 0.096 R1940 G1 225 Y 6 40883532 R326Q C T missense Het probably damaging 0.996 0.647 07/14/2014
56 213907 UTSW Mpdz 0.000 R1940 G1 225 Y 4 81361443 A669V G A missense Het probably benign 0.006 0.406 phenotype 07/14/2014
57 213962 UTSW Msra 0.121 R1940 G1 225 Y 14 64285056 G A splice site Het probably benign 0.090 phenotype 07/14/2014
58 213968 UTSW Muc13 0.053 R1940 G1 225 Y 16 33807911 T344S A T missense Het probably benign 0.025 0.090 phenotype 07/14/2014
59 213883 UTSW Myo3b 0.000 R1940 G1 225 Y 2 70258075 I866T T C missense Het probably benign 0.008 0.063 phenotype 07/14/2014
60 213901 UTSW Nbea 1.000 R1940 G1 225 Y 3 55953100 S1852G T C missense Het possibly damaging 0.783 0.081 phenotype 07/14/2014
61 213879 UTSW Ncf2 0.101 R1940 G1 225 Y 1 152834064 A G splice site Het probably benign phenotype 07/14/2014
62 213908 UTSW Nfyc 0.968 R1940 G1 225 Y 4 120773664 C A splice site Het probably benign 0.090 phenotype 07/14/2014
63 213924 UTSW Nop2 0.967 R1940 G1 225 Y 6 125134634 V110A T C missense Het probably benign 0.426 0.090 phenotype 07/14/2014
64 213977 UTSW Nrg2 0.205 R1940 G1 142 Y 18 36196844 C A unclassified Het probably benign 0.060 phenotype 07/14/2014
65 213961 UTSW Nrl 0.688 R1940 G1 225 Y 14 55522435 Y12H A G missense Het probably damaging 1.000 0.629 phenotype 07/14/2014
66 213952 UTSW Nrxn3 0.000 R1940 G1 225 Y 12 89260381 V635A T C missense Het probably damaging 0.976 0.188 phenotype 07/14/2014
67 213885 UTSW Olfr1014 0.109 R1940 G1 225 Y 2 85777171 S196T T A missense Het probably benign 0.000 0.090 phenotype 07/14/2014
68 213871 UTSW Olfr1415 0.083 R1940 G1 225 Y 1 92491735 T7S T A missense Het probably benign 0.144 0.208 phenotype 07/14/2014
69 213979 UTSW Olfr1423 0.368 R1940 G1 225 Y 19 12035911 V277G A C missense Het probably benign 0.065 0.216 phenotype 07/14/2014
70 213886 UTSW Olfr228 0.133 R1940 G1 225 Y 2 86483359 K128* T A nonsense Het probably null 0.976 phenotype 07/14/2014
71 213945 UTSW Papolg 0.916 R1940 G1 225 Y 11 23867279 N639K A T missense Het probably benign 0.002 0.096 phenotype 07/14/2014
72 213971 UTSW Paqr4 0.513 R1940 G1 158 Y 17 23737664 I242V T C missense Het probably damaging 1.000 0.563 07/14/2014
73 213887 UTSW Pramel6 0.074 R1940 G1 225 Y 2 87508732 K92M A T missense Het probably damaging 0.999 0.647 07/14/2014
74 213877 UTSW Prg4 0.124 R1940 G1 225 Y 1 150456023 T300A T C missense Het possibly damaging 0.528 0.179 phenotype 07/14/2014
75 213942 UTSW Ptprb 1.000 R1940 G1 225 Y 10 116319610 A T splice site Het probably benign 0.090 phenotype 07/14/2014
76 213916 UTSW Rab28 0.100 R1940 G1 225 Y 5 41625790 S216T A T missense Het probably benign 0.002 0.072 phenotype 07/14/2014
77 213974 UTSW Rrp1b 0.000 R1940 G1 225 Y 17 32056845 R455S A T missense Het possibly damaging 0.951 0.179 07/14/2014
78 213937 UTSW Sash1 1.000 R1940 G1 225 Y 10 8729932 M898K A T missense Het probably benign 0.000 0.090 phenotype 07/14/2014
79 213966 UTSW Scn8a 0.822 R1940 G1 225 Y 15 100970204 T310I C T missense Het probably benign 0.215 0.125 phenotype 07/14/2014
80 213891 UTSW Secisbp2l 0.736 R1940 G1 225 Y 2 125740339 D1066Y C A missense Het probably damaging 0.999 0.177 07/14/2014
81 213933 UTSW Sipa1l2 0.339 R1940 G1 225 Y 8 125480148 A G splice site Het probably benign phenotype 07/14/2014
82 213890 UTSW Slc12a1 0.227 R1940 G1 225 Y 2 125194193 T662A A G missense Het probably benign 0.051 0.108 phenotype 07/14/2014
83 213932 UTSW Slc12a4 0.298 R1940 G1 225 Y 8 105946037 I749V T C missense Het probably benign 0.293 0.104 phenotype 07/14/2014
84 213978 UTSW Slc22a27 0.060 R1940 G1 225 Y 19 7909727 S266P A G missense Het probably damaging 1.000 0.298 07/14/2014
85 213981 UTSW Slc25a14 0.000 R1940 G1 222 Y X 48651963 V210I G A missense Het probably benign 0.003 0.287 phenotype 07/14/2014
86 213980 UTSW Slit1 0.000 R1940 G1 225 N 19 41630776 N762I T A missense Het probably damaging 1.000 phenotype 07/14/2014
87 213957 UTSW Spata31d1b 0.063 R1940 G1 225 Y 13 59718021 D994E C A missense Het possibly damaging 0.911 0.063 07/14/2014
88 213950 UTSW Sphk1 0.000 R1940 G1 225 Y 11 116535850 I204V A G missense Het probably benign 0.001 0.090 phenotype 07/14/2014
89 213895 UTSW Srsf6 0.816 R1940 G1 225 Y 2 162934483 C T unclassified Het probably benign 0.160 phenotype 07/14/2014
90 213920 UTSW Svs1 0.054 R1940 G1 225 Y 6 48990073 K652* A T nonsense Het probably null 0.976 07/14/2014
91 213906 UTSW Tet2 1.000 R1940 G1 225 Y 3 133488638 T12A T C missense Het possibly damaging 0.682 0.179 phenotype 07/14/2014
92 213955 UTSW Tgfbi 0.093 R1940 G1 188 Y 13 56614314 Q70L A T missense Het possibly damaging 0.917 0.172 phenotype 07/14/2014
93 213936 UTSW Tlr9 0.123 R1940 G1 225 Y 9 106224647 L379P T C missense Het probably damaging 1.000 0.966 phenotype 07/14/2014
94 213951 UTSW Tnrc6c 0.000 R1940 G1 225 Y 11 117756023 D1450G A G missense Het possibly damaging 0.907 0.079 phenotype 07/14/2014
95 213967 UTSW Tra2b 1.000 R1940 G1 225 Y 16 22255045 A G unclassified Het probably benign 0.063 phenotype 07/14/2014
96 213909 UTSW Trit1 1.000 R1940 G1 225 Y 4 123054240 I451T T C missense Het probably benign 0.001 0.090 phenotype 07/14/2014
97 213911 UTSW Trnau1ap 0.952 R1940 G1 225 Y 4 132321803 Y30H A G missense Het probably damaging 0.995 0.163 phenotype 07/14/2014
98 213914 UTSW Ttc34 0.136 R1940 G1 225 Y 4 154865682 A1031T G A missense Het possibly damaging 0.804 0.242 07/14/2014
99 213913 UTSW Ubiad1 1.000 R1940 G1 225 Y 4 148444011 L147P A G missense Het probably damaging 1.000 0.956 phenotype 07/14/2014
100 213880 UTSW Ush2a 0.556 R1940 G1 225 Y 1 188951561 D4979G A G missense Het probably null 0.887 0.251 phenotype 07/14/2014
[records 1 to 100 of 108] next >> last >|