Incidental Mutations

69 incidental mutations are currently displayed, and affect 69 genes.
12 are Possibly Damaging.
27 are Probably Damaging.
24 are Probably Benign.
5 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 69 of 69] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 222244 UTSW 4930415L06Rik 0.190 R1980 G1 222 N X 89931445 V382E A T missense Het probably damaging 0.998 0.647 08/25/2014
2 222231 UTSW A730017C20Rik 0.000 R1980 G1 225 N 18 59075667 M129K T A missense Het probably damaging 0.957 08/25/2014
3 222185 UTSW Acly 1.000 R1980 G1 225 N 11 100495876 I620S A C missense Het possibly damaging 0.870 phenotype 08/25/2014
4 222110 UTSW Acot8 0.120 R1980 G1 225 N 2 164795044 F262S A G missense Het probably damaging 1.000 phenotype 08/25/2014
5 222162 UTSW Adgb 0.000 R1980 G1 225 N 10 10433498 V246I C T missense Het probably benign 0.000 08/25/2014
6 222132 UTSW Akap9 0.420 R1980 G1 225 N 5 3972771 M1200K T A missense Het probably damaging 0.994 phenotype 08/25/2014
7 222152 UTSW Alg11 1.000 R1980 G1 225 N 8 22061887 F16I T A missense Het possibly damaging 0.689 phenotype 08/25/2014
8 222204 UTSW Apol7c 0.053 R1980 G1 225 N 15 77526044 V234A A G missense Het probably benign 0.161 08/25/2014
9 222236 UTSW Arhgap19 0.000 R1980 G1 225 N 19 41788345 I122L T G missense Het possibly damaging 0.655 phenotype 08/25/2014
10 222234 UTSW Arhgef37 0.163 R1980 G1 225 N 18 61508696 S201P A G missense Het probably damaging 0.983 08/25/2014
11 222179 UTSW Asgr1 0.000 R1980 G1 184 N 11 70054946 D16V A T missense Het probably damaging 0.998 phenotype 08/25/2014
12 222181 UTSW Camta2 0.532 R1980 G1 225 N 11 70682482 C227S A T missense Het probably benign 0.428 phenotype 08/25/2014
13 222142 UTSW Cd22 0.000 R1980 G1 225 N 7 30873233 L317Q A T missense Het probably damaging 1.000 phenotype 08/25/2014
14 222098 UTSW Cenpf 0.636 R1980 G1 225 N 1 189653915 I2056K A T missense Het probably benign 0.037 phenotype 08/25/2014
15 222245 UTSW Cenpi R1980 G1 222 N X 134318033 F161L T A missense Het possibly damaging 0.628 phenotype 08/25/2014
16 222156 UTSW Ciapin1 1.000 R1980 G1 225 N 8 94832533 V43I C T missense Het probably benign 0.001 phenotype 08/25/2014
17 222200 UTSW Dach1 1.000 R1980 G1 225 N 14 97831341 L601P A G missense Het probably damaging 0.999 phenotype 08/25/2014
18 222223 UTSW Ddx11 1.000 R1980 G1 225 N 17 66148739 L711Q T A missense Het probably damaging 0.972 phenotype 08/25/2014
19 222229 UTSW Dsg1a 0.069 R1980 G1 225 N 18 20338650 N653I A T missense Het probably damaging 0.997 phenotype 08/25/2014
20 222198 UTSW Fezf2 0.807 R1980 G1 225 N 14 12344405 P261T G T missense Het probably benign 0.039 0.082 phenotype 08/25/2014
21 222102 UTSW Galnt5 0.000 R1980 G1 225 N 2 58024723 T C critical splice donor site 2 bp Het probably null phenotype 08/25/2014
22 222175 UTSW Gemin5 1.000 R1980 G1 225 N 11 58136917 L935P A G missense Het probably damaging 1.000 phenotype 08/25/2014
23 222192 UTSW Gm11273 R1980 G1 225 N 13 21501124 T99P T G missense Het possibly damaging 0.478 08/25/2014
24 222164 UTSW Gm9507 R1980 G1 186 N 10 77811685 C53* A T nonsense Het probably null 08/25/2014
25 222178 UTSW Irgm2 0.000 R1980 G1 225 N 11 58220076 I198V A G missense Het probably damaging 0.994 phenotype 08/25/2014
26 222219 UTSW Kcnh8 0.000 R1980 G1 217 N 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 08/25/2014
27 222202 UTSW Klf12 0.628 R1980 G1 225 N 14 100149726 A C splice site 6 bp Het probably null phenotype 08/25/2014
28 222209 UTSW Lpp 0.142 R1980 G1 225 N 16 24661701 P73L C T missense Het probably damaging 1.000 phenotype 08/25/2014
29 222112 UTSW Lrrc34 0.055 R1980 G1 225 N 3 30642741 H127Y G A missense Het probably benign 0.330 08/25/2014
30 222134 UTSW Lyar 0.303 R1980 G1 225 N 5 38224709 S12P T C missense Het probably damaging 0.999 08/25/2014
31 222114 UTSW Maml3 0.000 R1980 G1 107 N 3 52104052 I31T A G missense Het unknown phenotype 08/25/2014
32 222205 UTSW Mei1 0.358 R1980 G1 225 N 15 82103312 N859S A G missense Het probably benign 0.001 0.090 phenotype 08/25/2014
33 222128 UTSW Mysm1 0.834 R1980 G1 225 N 4 94952213 N655K A T missense Het probably benign 0.268 phenotype 08/25/2014
34 222122 UTSW Npnt 0.117 R1980 G1 135 N 3 132948132 I29M T C missense Het probably benign 0.044 phenotype 08/25/2014
35 222228 UTSW Nrxn1 0.000 R1980 G1 171 N 17 91088318 W137R A G missense Het probably benign 0.011 phenotype 08/25/2014
36 222188 UTSW Numb 1.000 R1980 G1 225 N 12 83797344 C T critical splice acceptor site Het probably null phenotype 08/25/2014
37 222096 UTSW Obsl1 0.288 R1980 G1 141 N 1 75505836 F130S A G missense Het probably damaging 1.000 08/25/2014
38 222106 UTSW Olfr1297 0.141 R1980 G1 225 N 2 111621241 I278F T A missense Het probably benign 0.003 0.090 phenotype 08/25/2014
39 222216 UTSW Olfr91 0.097 R1980 G1 225 N 17 37093403 Q157P T G missense Het probably damaging 0.995 phenotype 08/25/2014
40 222154 UTSW Pbx4 0.401 R1980 G1 225 N 8 69870126 V294A T C missense Het probably benign 0.001 phenotype 08/25/2014
41 222120 UTSW Pde4dip 1.000 R1980 G1 225 N 3 97756996 L524R A C missense Het possibly damaging 0.925 phenotype 08/25/2014
42 222126 UTSW Plppr1 0.314 R1980 G1 170 N 4 49337655 A319T G A missense Het probably benign 0.095 phenotype 08/25/2014
43 222116 UTSW Ppid 0.739 R1980 G1 225 N 3 79593618 I32F A T missense Het probably damaging 0.965 phenotype 08/25/2014
44 222158 UTSW Prkcsh 1.000 R1980 G1 222 N 9 22012868 D458G A G missense Het probably damaging 0.991 0.226 phenotype 08/25/2014
45 222136 UTSW Prr27 0.000 R1980 G1 225 N 5 87843402 E291G A G missense Het probably benign 0.032 08/25/2014
46 222173 UTSW Psme4 0.000 R1980 G1 225 N 11 30832615 K923N A T missense Het possibly damaging 0.843 phenotype 08/25/2014
47 222118 UTSW Rab25 0.092 R1980 G1 193 N 3 88543458 T45A T C missense Het probably damaging 0.971 phenotype 08/25/2014
48 222100 UTSW Rapgef1 1.000 R1980 G1 225 N 2 29722227 P630S C T missense Het probably benign 0.000 phenotype 08/25/2014
49 222160 UTSW Rasa2 0.118 R1980 G1 225 N 9 96570768 D355G T C missense Het probably damaging 0.988 phenotype 08/25/2014
50 222170 UTSW Rel 0.000 R1980 G1 225 N 11 23742761 G424D C T missense Het probably benign 0.000 0.090 phenotype 08/25/2014
51 222172 UTSW Rtn4 0.735 R1980 G1 225 N 11 29708634 E929D A T missense Het probably benign 0.002 phenotype 08/25/2014
52 222241 UTSW Samt3 0.027 R1980 G1 222 N X 86047134 M211L A C missense Het probably benign 0.008 0.090 08/25/2014
53 222238 UTSW Slk 1.000 R1980 G1 225 N 19 47611989 I151S T G missense Het probably damaging 1.000 phenotype 08/25/2014
54 222194 UTSW Spin1 1.000 R1980 G1 225 N 13 51144470 V175D T A missense Het probably damaging 1.000 phenotype 08/25/2014
55 222239 UTSW Ssxb10 0.027 R1980 G1 222 N X 8331019 D77G A G missense Het probably benign 0.002 0.090 08/25/2014
56 222221 UTSW Ticam1 0.000 R1980 G1 225 N 17 56271555 R180H C T missense Het probably damaging 0.993 0.082 phenotype 08/25/2014
57 222218 UTSW Tmem151b 0.000 R1980 G1 126 N 17 45545461 P351R G C missense Het possibly damaging 0.724 08/25/2014
58 222124 UTSW Tmod1 1.000 R1980 G1 225 N 4 46061043 Y10S A C missense Het probably damaging 0.999 phenotype 08/25/2014
59 222207 UTSW Tns2 0.000 R1980 G1 195 N 15 102108934 R281C C T missense Het probably damaging 1.000 0.202 phenotype 08/25/2014
60 222150 UTSW Trpm1 0.000 R1980 G1 225 N 7 64208434 Y225H T C missense Het possibly damaging 0.833 phenotype 08/25/2014
61 222104 UTSW Ttc17 0.601 R1980 G1 225 N 2 94326704 N411S T C missense Het possibly damaging 0.819 0.139 08/25/2014
62 222108 UTSW Tyro3 0.000 R1980 G1 225 N 2 119808817 D335G A G missense Het probably benign 0.000 phenotype 08/25/2014
63 222190 UTSW Unc79 1.000 R1980 G1 225 N 12 103011279 Y180* C A nonsense Het probably null phenotype 08/25/2014
64 222168 UTSW Upp1 0.267 R1980 G1 225 N 11 9134872 D197V A T missense Het possibly damaging 0.671 phenotype 08/25/2014
65 222214 UTSW Vmn1r226 0.050 R1980 G1 225 N 17 20688046 M180K T A missense Het possibly damaging 0.815 08/25/2014
66 222183 UTSW Vtn 0.000 R1980 G1 225 N 11 78501898 I434N T A missense Het probably damaging 0.983 phenotype 08/25/2014
67 222140 UTSW Zfp329 0.000 R1980 G1 225 N 7 12811468 N43I T A missense Het probably benign 0.000 0.090 08/25/2014
68 222146 UTSW Zfp819 0.091 R1980 G1 225 N 7 43616461 T47A A G missense Het probably benign 0.000 08/25/2014
69 222130 UTSW Zyg11b 0.614 R1980 G1 225 N 4 108265930 T280I G A missense Het probably damaging 0.985 08/25/2014
[records 1 to 69 of 69]