Incidental Mutations

90 incidental mutations are currently displayed, and affect 90 genes.
16 are Possibly Damaging.
36 are Probably Damaging.
28 are Probably Benign.
10 are Probably Null.
7 create premature stop codons.
1 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 90 of 90] per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 220059 UTSW 4930415L06Rik 0.219 R1982 G1 222 N X 89931445 V382E A T missense Het probably damaging 0.998 0.647 08/25/2014
2 219995 UTSW Aatk 0.185 R1982 G1 225 N 11 120013514 P252Q G T missense Het probably damaging 1.000 phenotype 08/25/2014
3 219859 UTSW Adamts4 0.000 R1982 G1 225 N 1 171258934 V765A T C missense Het probably benign 0.000 phenotype 08/25/2014
4 219917 UTSW Agfg2 0.000 R1982 G1 225 N 5 137664253 V184E A T missense Het possibly damaging 0.873 phenotype 08/25/2014
5 219973 UTSW Alas1 1.000 R1982 G1 225 N 9 106238185 I48N A T missense Het probably damaging 0.999 phenotype 08/25/2014
6 220025 UTSW Anks1 0.000 R1982 G1 225 N 17 27985121 V181A T C missense Het probably damaging 0.999 0.791 phenotype 08/25/2014
7 220015 UTSW Anxa8 0.000 R1982 G1 225 N 14 34096570 R261S A T missense Het probably damaging 0.999 phenotype 08/25/2014
8 220043 UTSW Aqp4 0.124 R1982 G1 225 N 18 15393551 D291G T C missense Het probably damaging 0.980 0.106 phenotype 08/25/2014
9 219869 UTSW Atrn 0.000 R1982 G1 225 N 2 130970222 R696G A G missense Het probably benign 0.000 phenotype 08/25/2014
10 219966 UTSW Barx2 0.625 R1982 G1 225 N 9 31913012 I27S A C missense Het probably damaging 0.999 phenotype 08/25/2014
11 220029 UTSW Btnl1 0.000 R1982 G1 225 N 17 34379751 I114L A T missense Het possibly damaging 0.813 08/25/2014
12 219863 UTSW Casq1 0.000 R1982 G1 225 N 1 172215530 A200T C T missense Het probably damaging 1.000 phenotype 08/25/2014
13 219968 UTSW Ccdc33 0.000 R1982 G1 225 N 9 58117168 E225D T A missense Het probably benign 0.074 08/25/2014
14 219861 UTSW Cd84 0.000 R1982 G1 225 N 1 171884585 C A splice site Het probably null phenotype 08/25/2014
15 219939 UTSW Ceacam9 0.000 R1982 G1 225 N 7 16725307 L177R T G missense Het probably benign 0.159 0.090 phenotype 08/25/2014
16 220061 UTSW Cenpi R1982 G1 222 N X 134318033 F161L T A missense Het possibly damaging 0.628 phenotype 08/25/2014
17 219971 UTSW Cep63 0.624 R1982 G1 225 N 9 102602880 K251E T C missense Het probably damaging 0.986 phenotype 08/25/2014
18 220005 UTSW Cetn3 0.547 R1982 G1 225 N 13 81784697 E25G A G missense Het probably damaging 0.995 phenotype 08/25/2014
19 220023 UTSW Crybg3 0.227 R1982 G1 225 N 16 59544125 D2378G T C missense Het possibly damaging 0.851 08/25/2014
20 219959 UTSW Ddx19b 0.000 R1982 G1 225 N 8 111009343 T357A T C missense Het possibly damaging 0.879 0.916 phenotype 08/25/2014
21 219956 UTSW Dpep2 0.172 R1982 G1 225 N 8 105989455 Y266* A C nonsense Het probably null phenotype 08/25/2014
22 219927 UTSW Dqx1 0.056 R1982 G1 225 N 6 83058577 D24N G A missense Het probably damaging 1.000 08/25/2014
23 220045 UTSW Dsg4 0.750 R1982 G1 225 N 18 20471212 Y912F A T missense Het probably damaging 0.999 phenotype 08/25/2014
24 219923 UTSW Fam71f2 0.060 R1982 G1 225 N 6 29285922 T69A A G missense Het probably benign 0.353 08/25/2014
25 220009 UTSW Fezf2 0.905 R1982 G1 225 N 14 12344405 P261T G T missense Het probably benign 0.039 0.082 phenotype 08/25/2014
26 219855 UTSW Fmo1 0.067 R1982 G1 225 N 1 162839756 I163M T C missense Het possibly damaging 0.831 phenotype 08/25/2014
27 219949 UTSW Gatad2a R1982 G1 195 N 8 69913132 R428* G A nonsense Het probably null phenotype 08/25/2014
28 219929 UTSW Gfpt1 1.000 R1982 G1 225 N 6 87054630 F85I T A missense Het possibly damaging 0.901 phenotype 08/25/2014
29 219925 UTSW Gimap7 0.122 R1982 G1 225 N 6 48724241 I254F A T missense Het possibly damaging 0.831 phenotype 08/25/2014
30 219921 UTSW Glcci1 0.071 R1982 G1 225 N 6 8592980 S261P T C missense Het probably damaging 1.000 phenotype 08/25/2014
31 220051 UTSW Glis3 0.365 R1982 G1 225 N 19 28531274 F437I A T missense Het probably damaging 1.000 phenotype 08/25/2014
32 220027 UTSW Glp1r 0.000 R1982 G1 225 N 17 30925627 S258* C A nonsense Het probably null phenotype 08/25/2014
33 219899 UTSW Gm13023 0.115 R1982 G1 225 N 4 143795150 H445Q C A missense Het probably benign 0.018 08/25/2014
34 220031 UTSW Gm7030 0.164 R1982 G1 225 N 17 36128722 D122V T A missense Het probably damaging 0.990 0.647 08/25/2014
35 219952 UTSW Gpt2 0.086 R1982 G1 225 N 8 85516203 A288V C T missense Het possibly damaging 0.753 phenotype 08/25/2014
36 219993 UTSW Grin2c 0.301 R1982 G1 225 N 11 115260905 S76R G T missense Het possibly damaging 0.956 phenotype 08/25/2014
37 219909 UTSW Guf1 0.756 R1982 G1 225 N 5 69567226 Y447* T A nonsense Het probably null phenotype 08/25/2014
38 219999 UTSW Hectd1 1.000 R1982 G1 225 N 12 51785841 L916V A C missense Het probably damaging 0.966 phenotype 08/25/2014
39 219879 UTSW Hnf4g 0.200 R1982 G1 225 N 3 3638208 K96E A G missense Het probably damaging 0.987 phenotype 08/25/2014
40 219951 UTSW Hsh2d 0.054 R1982 G1 225 N 8 72200460 D229N G A missense Het probably benign 0.006 0.086 phenotype 08/25/2014
41 219865 UTSW Ifi207 0.069 R1982 G1 225 N 1 173735239 M114L T G missense Het probably benign 0.008 08/25/2014
42 219989 UTSW Ifi35 0.191 R1982 G1 225 N 11 101458286 E252V A T missense Het probably damaging 0.988 08/25/2014
43 219965 UTSW Igsf9b 0.536 R1982 G1 225 N 9 27322239 R345H G A missense Het possibly damaging 0.819 08/25/2014
44 220011 UTSW Itih3 0.067 R1982 G1 167 N 14 30923583 T C unclassified Het probably benign phenotype 08/25/2014
45 220037 UTSW Kcnh8 0.000 R1982 G1 197 N 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 08/25/2014
46 219997 UTSW Kidins220 1.000 R1982 G1 225 N 12 25051194 M1252L A T missense Het probably benign 0.011 phenotype 08/25/2014
47 219856 UTSW Kifap3 1.000 R1982 G1 225 N 1 163862022 L525* T A nonsense Het probably null phenotype 08/25/2014
48 219980 UTSW Limk2 0.141 R1982 G1 225 N 11 3355461 D35E A T missense Het probably benign 0.003 phenotype 08/25/2014
49 219991 UTSW Lrrc37a 0.145 R1982 G1 225 N 11 103498966 P1878S G A missense Het probably benign 0.201 08/25/2014
50 219932 UTSW Mansc4 0.082 R1982 G1 225 N 6 147075675 I148F T A missense Het probably benign 0.448 0.070 08/25/2014
51 220021 UTSW Mei1 0.212 R1982 G1 225 N 15 82103312 N859S A G missense Het probably benign 0.001 0.090 phenotype 08/25/2014
52 220041 UTSW Mib1 1.000 R1982 G1 225 N 18 10812064 D987G A G missense Het probably damaging 1.000 phenotype 08/25/2014
53 219872 UTSW Mroh8 0.918 R1982 G1 225 N 2 157271975 V132A A G missense Het possibly damaging 0.522 phenotype 08/25/2014
54 219885 UTSW Npnt 0.130 R1982 G1 140 N 3 132948132 I29M T C missense Het probably benign 0.044 phenotype 08/25/2014
55 220053 UTSW Nrap 0.000 R1982 G1 225 N 19 56384105 D138G T C missense Het probably damaging 0.985 08/25/2014
56 219987 UTSW Olfr1 0.128 R1982 G1 225 N 11 73395092 I310N A T missense Het probably benign 0.004 phenotype 08/25/2014
57 219935 UTSW Olfr5 0.124 R1982 G1 225 N 7 6480932 M75V T C missense Het probably benign 0.292 0.090 phenotype 08/25/2014
58 219943 UTSW Olfr512 0.095 R1982 G1 225 N 7 108713695 Y102C A G missense Het probably damaging 1.000 phenotype 08/25/2014
59 220033 UTSW Olfr91 0.111 R1982 G1 225 N 17 37093808 E22V T A missense Het probably damaging 0.977 phenotype 08/25/2014
60 219947 UTSW Osbpl5 0.000 R1982 G1 225 N 7 143741671 A C critical splice donor site 2 bp Het probably null phenotype 08/25/2014
61 220049 UTSW Pcna-ps2 0.919 R1982 G1 225 N 19 9283683 V102A T C missense Het possibly damaging 0.609 08/25/2014
62 219931 UTSW Pik3c2g 0.117 R1982 G1 225 N 6 139622548 S221P T C missense Het probably damaging 0.968 phenotype 08/25/2014
63 219978 UTSW Plppr3 0.095 R1982 G1 225 N 10 79866425 I271T A G missense Het probably damaging 0.996 phenotype 08/25/2014
64 219919 UTSW Prkar1b 0.236 R1982 G1 225 N 5 139127643 A41T C T missense Het probably benign 0.057 phenotype 08/25/2014
65 219963 UTSW Prkcsh 1.000 R1982 G1 217 N 9 22012868 D458G A G missense Het probably damaging 0.991 0.226 phenotype 08/25/2014
66 219944 UTSW Prr14 0.129 R1982 G1 225 N 7 127475490 R398L G T missense Het possibly damaging 0.873 phenotype 08/25/2014
67 219897 UTSW Ptafr 0.000 R1982 G1 225 N 4 132579985 R229G A G missense Het probably damaging 0.991 phenotype 08/25/2014
68 220013 UTSW Rbp3 0.680 R1982 G1 225 N 14 33954545 F150S T C missense Het probably damaging 0.986 phenotype 08/25/2014
69 219984 UTSW Rel 0.000 R1982 G1 225 N 11 23742761 G424D C T missense Het probably benign 0.000 0.090 phenotype 08/25/2014
70 219891 UTSW Rlf 1.000 R1982 G1 225 N 4 121150112 Y557C T C missense Het probably damaging 1.000 phenotype 08/25/2014
71 220057 UTSW Samt3 0.027 R1982 G1 222 N X 86047134 M211L A C missense Het probably benign 0.008 0.090 08/25/2014
72 220019 UTSW Selenop 0.347 R1982 G1 225 N 15 3275694 I111F A T missense Het probably damaging 1.000 phenotype 08/25/2014
73 219881 UTSW Slc2a2 1.000 R1982 G1 225 N 3 28717441 M173I G A missense Het probably benign 0.356 phenotype 08/25/2014
74 219867 UTSW Slc43a1 0.080 R1982 G1 225 N 2 84856889 G361V G T missense Het possibly damaging 0.941 phenotype 08/25/2014
75 219907 UTSW Slit2 1.000 R1982 G1 225 N 5 48249836 V870M G A missense Het probably damaging 0.999 phenotype 08/25/2014
76 220055 UTSW Ssxb10 0.027 R1982 G1 222 N X 8331019 D77G A G missense Het probably benign 0.002 0.090 08/25/2014
77 219904 UTSW Stk32b 0.085 R1982 G1 225 N 5 37649114 I29F T A missense Het probably damaging 0.990 phenotype 08/25/2014
78 219887 UTSW Stra6l 0.000 R1982 G1 225 N 4 45867237 C161* T A nonsense Het probably null 08/25/2014
79 220003 UTSW Tecpr2 0.000 R1982 G1 225 N 12 110954785 M1264K T A missense Het probably benign 0.068 0.241 phenotype 08/25/2014
80 219874 UTSW Tfap2c 1.000 R1982 G1 225 N 2 172557236 I468F A T missense Het probably damaging 0.984 phenotype 08/25/2014
81 220039 UTSW Ticam1 0.000 R1982 G1 225 N 17 56271555 R180H C T missense Het probably damaging 0.993 0.082 phenotype 08/25/2014
82 219889 UTSW Tlr4 0.000 R1982 G1 225 N 4 66841035 N688K T A missense Het probably benign 0.403 phenotype 08/25/2014
83 219895 UTSW Tmem35b 0.077 R1982 G1 225 N 4 127126053 A T intron Het probably benign 08/25/2014
84 219911 UTSW Ugt2b34 0.169 R1982 G1 225 N 5 86906313 E203G T C missense Het probably damaging 0.999 08/25/2014
85 220035 UTSW Vegfa 1.000 R1982 G1 225 N 17 46018860 *393G A C makesense Het probably null phenotype 08/25/2014
86 219913 UTSW Vmn2r16 0.135 R1982 G1 225 N 5 109364024 V699A T C missense Het probably benign 0.014 08/25/2014
87 219936 UTSW Zfp324 0.069 R1982 G1 159 N 7 12971218 S445P T C missense Het probably damaging 0.998 08/25/2014
88 219903 UTSW Zfp982 0.156 R1982 G1 144 N 4 147512592 C135* T A nonsense Het probably null 08/25/2014
89 219901 UTSW Zfp990 0.059 R1982 G1 225 N 4 145536869 N146H A C missense Het probably damaging 0.992 08/25/2014
90 220001 UTSW Zfyve26 0.000 R1982 G1 225 N 12 79255243 Y431H A G missense Het possibly damaging 0.546 phenotype 08/25/2014
[records 1 to 90 of 90]