Incidental Mutations

90 incidental mutations are currently displayed, and affect 90 genes.
16 are Possibly Damaging.
36 are Probably Damaging.
28 are Probably Benign.
10 are Probably Null.
7 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 90 of 90] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 220059 UTSW 4930415L06Rik 0.219 R1982 G1 222 N X 89931445 V382E A T missense Het probably damaging 0.998 0.647 08/25/2014
2 219995 UTSW Aatk 0.185 R1982 G1 225 N 11 120013514 P252Q G T missense Het probably damaging 1.000 phenotype 08/25/2014
3 219859 UTSW Adamts4 0.000 R1982 G1 225 N 1 171258934 V765A T C missense Het probably benign 0.000 phenotype 08/25/2014
4 219917 UTSW Agfg2 0.000 R1982 G1 225 N 5 137664253 V184E A T missense Het possibly damaging 0.873 phenotype 08/25/2014
5 219973 UTSW Alas1 1.000 R1982 G1 225 N 9 106238185 I48N A T missense Het probably damaging 0.999 phenotype 08/25/2014
6 220025 UTSW Anks1 0.000 R1982 G1 225 N 17 27985121 V181A T C missense Het probably damaging 0.999 0.791 phenotype 08/25/2014
7 220015 UTSW Anxa8 0.000 R1982 G1 225 N 14 34096570 R261S A T missense Het probably damaging 0.999 phenotype 08/25/2014
8 220043 UTSW Aqp4 0.124 R1982 G1 225 N 18 15393551 D291G T C missense Het probably damaging 0.980 0.106 phenotype 08/25/2014
9 219869 UTSW Atrn 0.000 R1982 G1 225 N 2 130970222 R696G A G missense Het probably benign 0.000 phenotype 08/25/2014
10 219966 UTSW Barx2 0.625 R1982 G1 225 N 9 31913012 I27S A C missense Het probably damaging 0.999 phenotype 08/25/2014
11 220029 UTSW Btnl1 0.000 R1982 G1 225 N 17 34379751 I114L A T missense Het possibly damaging 0.813 08/25/2014
12 219863 UTSW Casq1 0.000 R1982 G1 225 N 1 172215530 A200T C T missense Het probably damaging 1.000 phenotype 08/25/2014
13 219968 UTSW Ccdc33 0.000 R1982 G1 225 N 9 58117168 E225D T A missense Het probably benign 0.074 08/25/2014
14 219861 UTSW Cd84 0.000 R1982 G1 225 N 1 171884585 C A splice site Het probably null phenotype 08/25/2014
15 219939 UTSW Ceacam9 0.000 R1982 G1 225 N 7 16725307 L177R T G missense Het probably benign 0.159 0.090 phenotype 08/25/2014
16 220061 UTSW Cenpi R1982 G1 222 N X 134318033 F161L T A missense Het possibly damaging 0.628 phenotype 08/25/2014
17 219971 UTSW Cep63 0.624 R1982 G1 225 N 9 102602880 K251E T C missense Het probably damaging 0.986 phenotype 08/25/2014
18 220005 UTSW Cetn3 0.547 R1982 G1 225 N 13 81784697 E25G A G missense Het probably damaging 0.995 phenotype 08/25/2014
19 220023 UTSW Crybg3 0.227 R1982 G1 225 N 16 59544125 D2378G T C missense Het possibly damaging 0.851 08/25/2014
20 219959 UTSW Ddx19b 0.000 R1982 G1 225 N 8 111009343 T357A T C missense Het possibly damaging 0.879 0.916 phenotype 08/25/2014
21 219956 UTSW Dpep2 0.172 R1982 G1 225 N 8 105989455 Y266* A C nonsense Het probably null phenotype 08/25/2014
22 219927 UTSW Dqx1 0.056 R1982 G1 225 N 6 83058577 D24N G A missense Het probably damaging 1.000 08/25/2014
23 220045 UTSW Dsg4 0.750 R1982 G1 225 N 18 20471212 Y912F A T missense Het probably damaging 0.999 phenotype 08/25/2014
24 219923 UTSW Fam71f2 0.060 R1982 G1 225 N 6 29285922 T69A A G missense Het probably benign 0.353 08/25/2014
25 220009 UTSW Fezf2 0.905 R1982 G1 225 N 14 12344405 P261T G T missense Het probably benign 0.039 0.082 phenotype 08/25/2014
26 219855 UTSW Fmo1 0.067 R1982 G1 225 N 1 162839756 I163M T C missense Het possibly damaging 0.831 phenotype 08/25/2014
27 219949 UTSW Gatad2a R1982 G1 195 N 8 69913132 R428* G A nonsense Het probably null phenotype 08/25/2014
28 219929 UTSW Gfpt1 1.000 R1982 G1 225 N 6 87054630 F85I T A missense Het possibly damaging 0.901 phenotype 08/25/2014
29 219925 UTSW Gimap7 0.122 R1982 G1 225 N 6 48724241 I254F A T missense Het possibly damaging 0.831 phenotype 08/25/2014
30 219921 UTSW Glcci1 0.071 R1982 G1 225 N 6 8592980 S261P T C missense Het probably damaging 1.000 phenotype 08/25/2014
31 220051 UTSW Glis3 0.365 R1982 G1 225 N 19 28531274 F437I A T missense Het probably damaging 1.000 phenotype 08/25/2014
32 220027 UTSW Glp1r 0.000 R1982 G1 225 N 17 30925627 S258* C A nonsense Het probably null phenotype 08/25/2014
33 219899 UTSW Gm13023 0.115 R1982 G1 225 N 4 143795150 H445Q C A missense Het probably benign 0.018 08/25/2014
34 220031 UTSW Gm7030 0.164 R1982 G1 225 N 17 36128722 D122V T A missense Het probably damaging 0.990 0.647 08/25/2014
35 219952 UTSW Gpt2 0.086 R1982 G1 225 N 8 85516203 A288V C T missense Het possibly damaging 0.753 phenotype 08/25/2014
36 219993 UTSW Grin2c 0.301 R1982 G1 225 N 11 115260905 S76R G T missense Het possibly damaging 0.956 phenotype 08/25/2014
37 219909 UTSW Guf1 0.756 R1982 G1 225 N 5 69567226 Y447* T A nonsense Het probably null phenotype 08/25/2014
38 219999 UTSW Hectd1 1.000 R1982 G1 225 N 12 51785841 L916V A C missense Het probably damaging 0.966 phenotype 08/25/2014
39 219879 UTSW Hnf4g 0.200 R1982 G1 225 N 3 3638208 K96E A G missense Het probably damaging 0.987 phenotype 08/25/2014
40 219951 UTSW Hsh2d 0.054 R1982 G1 225 N 8 72200460 D229N G A missense Het probably benign 0.006 0.086 phenotype 08/25/2014
41 219865 UTSW Ifi207 0.069 R1982 G1 225 N 1 173735239 M114L T G missense Het probably benign 0.008 08/25/2014
42 219989 UTSW Ifi35 0.191 R1982 G1 225 N 11 101458286 E252V A T missense Het probably damaging 0.988 08/25/2014
43 219965 UTSW Igsf9b 0.536 R1982 G1 225 N 9 27322239 R345H G A missense Het possibly damaging 0.819 08/25/2014
44 220011 UTSW Itih3 0.067 R1982 G1 167 N 14 30923583 T C unclassified Het probably benign phenotype 08/25/2014
45 220037 UTSW Kcnh8 0.000 R1982 G1 197 N 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 08/25/2014
46 219997 UTSW Kidins220 1.000 R1982 G1 225 N 12 25051194 M1252L A T missense Het probably benign 0.011 phenotype 08/25/2014
47 219856 UTSW Kifap3 1.000 R1982 G1 225 N 1 163862022 L525* T A nonsense Het probably null phenotype 08/25/2014
48 219980 UTSW Limk2 0.141 R1982 G1 225 N 11 3355461 D35E A T missense Het probably benign 0.003 phenotype 08/25/2014
49 219991 UTSW Lrrc37a 0.145 R1982 G1 225 N 11 103498966 P1878S G A missense Het probably benign 0.201 08/25/2014
50 219932 UTSW Mansc4 0.082 R1982 G1 225 N 6 147075675 I148F T A missense Het probably benign 0.448 0.070 08/25/2014
51 220021 UTSW Mei1 0.212 R1982 G1 225 N 15 82103312 N859S A G missense Het probably benign 0.001 0.090 phenotype 08/25/2014
52 220041 UTSW Mib1 1.000 R1982 G1 225 N 18 10812064 D987G A G missense Het probably damaging 1.000 phenotype 08/25/2014
53 219872 UTSW Mroh8 0.918 R1982 G1 225 N 2 157271975 V132A A G missense Het possibly damaging 0.522 phenotype 08/25/2014
54 219885 UTSW Npnt 0.130 R1982 G1 140 N 3 132948132 I29M T C missense Het probably benign 0.044 phenotype 08/25/2014
55 220053 UTSW Nrap 0.000 R1982 G1 225 N 19 56384105 D138G T C missense Het probably damaging 0.985 08/25/2014
56 219987 UTSW Olfr1 0.128 R1982 G1 225 N 11 73395092 I310N A T missense Het probably benign 0.004 phenotype 08/25/2014
57 219935 UTSW Olfr5 0.124 R1982 G1 225 N 7 6480932 M75V T C missense Het probably benign 0.292 0.090 phenotype 08/25/2014
58 219943 UTSW Olfr512 0.095 R1982 G1 225 N 7 108713695 Y102C A G missense Het probably damaging 1.000 phenotype 08/25/2014
59 220033 UTSW Olfr91 0.111 R1982 G1 225 N 17 37093808 E22V T A missense Het probably damaging 0.977 phenotype 08/25/2014
60 219947 UTSW Osbpl5 0.000 R1982 G1 225 N 7 143741671 A C critical splice donor site 2 bp Het probably null phenotype 08/25/2014
61 220049 UTSW Pcna-ps2 0.919 R1982 G1 225 N 19 9283683 V102A T C missense Het possibly damaging 0.609 08/25/2014
62 219931 UTSW Pik3c2g 0.117 R1982 G1 225 N 6 139622548 S221P T C missense Het probably damaging 0.968 phenotype 08/25/2014
63 219978 UTSW Plppr3 0.095 R1982 G1 225 N 10 79866425 I271T A G missense Het probably damaging 0.996 phenotype 08/25/2014
64 219919 UTSW Prkar1b 0.236 R1982 G1 225 N 5 139127643 A41T C T missense Het probably benign 0.057 phenotype 08/25/2014
65 219963 UTSW Prkcsh 1.000 R1982 G1 217 N 9 22012868 D458G A G missense Het probably damaging 0.991 0.226 phenotype 08/25/2014
66 219944 UTSW Prr14 0.129 R1982 G1 225 N 7 127475490 R398L G T missense Het possibly damaging 0.873 phenotype 08/25/2014
67 219897 UTSW Ptafr 0.000 R1982 G1 225 N 4 132579985 R229G A G missense Het probably damaging 0.991 phenotype 08/25/2014
68 220013 UTSW Rbp3 0.680 R1982 G1 225 N 14 33954545 F150S T C missense Het probably damaging 0.986 phenotype 08/25/2014
69 219984 UTSW Rel 0.000 R1982 G1 225 N 11 23742761 G424D C T missense Het probably benign 0.000 0.090 phenotype 08/25/2014
70 219891 UTSW Rlf 1.000 R1982 G1 225 N 4 121150112 Y557C T C missense Het probably damaging 1.000 phenotype 08/25/2014
71 220057 UTSW Samt3 0.027 R1982 G1 222 N X 86047134 M211L A C missense Het probably benign 0.008 0.090 08/25/2014
72 220019 UTSW Selenop 0.347 R1982 G1 225 N 15 3275694 I111F A T missense Het probably damaging 1.000 phenotype 08/25/2014
73 219881 UTSW Slc2a2 1.000 R1982 G1 225 N 3 28717441 M173I G A missense Het probably benign 0.356 phenotype 08/25/2014
74 219867 UTSW Slc43a1 0.080 R1982 G1 225 N 2 84856889 G361V G T missense Het possibly damaging 0.941 phenotype 08/25/2014
75 219907 UTSW Slit2 1.000 R1982 G1 225 N 5 48249836 V870M G A missense Het probably damaging 0.999 phenotype 08/25/2014
76 220055 UTSW Ssxb10 0.027 R1982 G1 222 N X 8331019 D77G A G missense Het probably benign 0.002 0.090 08/25/2014
77 219904 UTSW Stk32b 0.085 R1982 G1 225 N 5 37649114 I29F T A missense Het probably damaging 0.990 phenotype 08/25/2014
78 219887 UTSW Stra6l 0.000 R1982 G1 225 N 4 45867237 C161* T A nonsense Het probably null 08/25/2014
79 220003 UTSW Tecpr2 0.000 R1982 G1 225 N 12 110954785 M1264K T A missense Het probably benign 0.068 0.241 phenotype 08/25/2014
80 219874 UTSW Tfap2c 1.000 R1982 G1 225 N 2 172557236 I468F A T missense Het probably damaging 0.984 phenotype 08/25/2014
81 220039 UTSW Ticam1 0.000 R1982 G1 225 N 17 56271555 R180H C T missense Het probably damaging 0.993 0.082 phenotype 08/25/2014
82 219889 UTSW Tlr4 0.000 R1982 G1 225 N 4 66841035 N688K T A missense Het probably benign 0.403 phenotype 08/25/2014
83 219895 UTSW Tmem35b 0.077 R1982 G1 225 N 4 127126053 A T intron Het probably benign 08/25/2014
84 219911 UTSW Ugt2b34 0.169 R1982 G1 225 N 5 86906313 E203G T C missense Het probably damaging 0.999 08/25/2014
85 220035 UTSW Vegfa 1.000 R1982 G1 225 N 17 46018860 *393G A C makesense Het probably null phenotype 08/25/2014
86 219913 UTSW Vmn2r16 0.135 R1982 G1 225 N 5 109364024 V699A T C missense Het probably benign 0.014 08/25/2014
87 219936 UTSW Zfp324 0.069 R1982 G1 159 N 7 12971218 S445P T C missense Het probably damaging 0.998 08/25/2014
88 219903 UTSW Zfp982 0.156 R1982 G1 144 N 4 147512592 C135* T A nonsense Het probably null 08/25/2014
89 219901 UTSW Zfp990 0.059 R1982 G1 225 N 4 145536869 N146H A C missense Het probably damaging 0.992 08/25/2014
90 220001 UTSW Zfyve26 0.000 R1982 G1 225 N 12 79255243 Y431H A G missense Het possibly damaging 0.546 phenotype 08/25/2014
[records 1 to 90 of 90]