Incidental Mutations

83 incidental mutations are currently displayed, and affect 83 genes.
10 are Possibly Damaging.
33 are Probably Damaging.
28 are Probably Benign.
11 are Probably Null.
1 create premature stop codons.
6 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 83 of 83] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 222974 UTSW 1700025C18Rik R2016 G1 225 N 2 165079026 D29G T C missense Het unknown 08/25/2014
2 223058 UTSW Abca13 0.000 R2016 G1 225 N 11 9290619 L827F A T missense Het probably damaging 1.000 phenotype 08/25/2014
3 223070 UTSW Abca8a 0.089 R2016 G1 225 N 11 110070387 F570L A G missense Het probably damaging 0.992 08/25/2014
4 223074 UTSW Adck1 0.000 R2016 G1 225 N 12 88461092 I493N T A missense Het probably damaging 0.999 08/25/2014
5 222994 UTSW Adra2c 0.377 R2016 G1 225 N 5 35280312 C143R T C missense Het probably damaging 1.000 phenotype 08/25/2014
6 223014 UTSW Akap13 1.000 R2016 G1 225 N 7 75704531 T1800M C T missense Het probably damaging 0.992 phenotype 08/25/2014
7 223030 UTSW Angpt2 0.764 R2016 G1 225 N 8 18705731 N240S T C missense Het probably damaging 0.960 phenotype 08/25/2014
8 223072 UTSW Apob 0.908 R2016 G1 225 N 12 8007751 D2078N G A missense Het possibly damaging 0.483 phenotype 08/25/2014
9 223116 UTSW Atp8b1 0.000 R2016 G1 225 N 18 64540334 N989S T C missense Het probably damaging 1.000 phenotype 08/25/2014
10 223060 UTSW B3gnt2 0.951 R2016 G1 225 N 11 22836621 D189G T C missense Het probably damaging 1.000 phenotype 08/25/2014
11 223010 UTSW Bcam 0.000 R2016 G1 225 N 7 19760349 T374M G A missense Het probably benign 0.385 phenotype 08/25/2014
12 223016 UTSW Blm 1.000 R2016 G1 225 N 7 80505926 D335G T C missense Het probably benign 0.259 phenotype 08/25/2014
13 222969 UTSW Cbfa2t2 0.701 R2016 G1 225 N 2 154517807 L264P T C missense Het probably damaging 0.998 phenotype 08/25/2014
14 223028 UTSW Col4a2 1.000 R2016 G1 225 N 8 11445086 F1515L T C missense Het probably benign 0.035 phenotype 08/25/2014
15 223132 UTSW Csf2ra 0.080 R2016 G1 108 N 19 61226893 M95L T G missense Het probably benign 0.015 phenotype 08/25/2014
16 223130 UTSW Cyp2c70 0.092 R2016 G1 225 N 19 40164412 T300S T A missense Het possibly damaging 0.936 08/25/2014
17 223109 UTSW Cyp4f15 0.527 R2016 G1 225 N 17 32702159 H440L A T missense Het probably damaging 0.999 phenotype 08/25/2014
18 223038 UTSW Dcaf1 1.000 R2016 G1 225 N 9 106839088 D360E T A missense Het probably benign 0.406 phenotype 08/25/2014
19 222945 UTSW Ddr2 0.000 R2016 G1 225 N 1 169984968 M652V T C missense Het probably damaging 0.999 phenotype 08/25/2014
20 223066 UTSW Dnah2 0.000 R2016 G1 225 N 11 69437070 I3370F T A missense Het probably damaging 0.972 phenotype 08/25/2014
21 222992 UTSW Dpysl5 0.267 R2016 G1 225 N 5 30791597 D399N G A missense Het probably damaging 1.000 0.939 phenotype 08/25/2014
22 223062 UTSW Efemp1 0.000 R2016 G1 225 N 11 28921613 R376L G T missense Het probably damaging 0.997 phenotype 08/25/2014
23 223018 UTSW Efl1 0.245 R2016 G1 225 N 7 82753709 D673A A C missense Het probably damaging 1.000 phenotype 08/25/2014
24 222962 UTSW Eid1 0.383 R2016 G1 225 N 2 125673201 M4V A G missense Het probably benign 0.014 08/25/2014
25 223013 UTSW Emc10 0.000 R2016 G1 166 N 7 44493192 R109W G A missense Het probably damaging 1.000 0.305 phenotype 08/25/2014
26 222972 UTSW Emilin3 0.000 R2016 G1 225 N 2 160909610 R170C G A missense Het possibly damaging 0.846 08/25/2014
27 223086 UTSW Erap1 0.100 R2016 G1 225 N 13 74664151 W362R T C missense Het probably damaging 1.000 phenotype 08/25/2014
28 223079 UTSW Fam208b 0.121 R2016 G1 225 N 13 3576770 I1060K A T missense Het probably benign 0.413 08/25/2014
29 223107 UTSW Fam234a 0.077 R2016 G1 225 N 17 26218316 F91L A G missense Het probably benign 0.070 08/25/2014
30 223008 UTSW Fam71e2 0.086 R2016 G1 225 N 7 4759398 I244N A T missense Het probably damaging 0.997 08/25/2014
31 223004 UTSW Flnc 1.000 R2016 G1 225 N 6 29443797 G A critical splice donor site 1 bp Het probably null phenotype 08/25/2014
32 222951 UTSW Fsip2 0.155 R2016 G1 225 N 2 82982732 K3132E A G missense Het possibly damaging 0.528 phenotype 08/25/2014
33 223040 UTSW Gm10608 0.082 R2016 G1 103 N 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA small deletion Het probably benign 0.090 08/25/2014
34 223091 UTSW Gnl3 1.000 R2016 G1 225 N 14 31016369 A G unclassified Het probably null phenotype 08/25/2014
35 223105 UTSW Has1 0.000 R2016 G1 225 N 17 17848270 I274N A T missense Het probably damaging 0.999 phenotype 08/25/2014
36 223103 UTSW Itsn1 0.000 R2016 G1 225 N 16 91905501 T C critical splice donor site 2 bp Het probably null phenotype 08/25/2014
37 223113 UTSW Kcnh8 0.000 R2016 G1 184 N 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 08/25/2014
38 223085 UTSW Kif13a 0.459 R2016 G1 225 N 13 46810799 D475G T C missense Het probably benign 0.134 phenotype 08/25/2014
39 222943 UTSW Klhl20 0.151 R2016 G1 225 N 1 161103038 M298K A T missense Het probably damaging 0.977 phenotype 08/25/2014
40 222946 UTSW Kynu 0.000 R2016 G1 225 N 2 43604277 G241* G T nonsense Het probably null phenotype 08/25/2014
41 222984 UTSW Lrif1 0.091 R2016 G1 225 N 3 106732206 L202F G T missense Het possibly damaging 0.936 08/25/2014
42 223118 UTSW Lrp5 0.922 R2016 G1 194 N 19 3610056 K1003E T C missense Het probably benign 0.041 phenotype 08/25/2014
43 223128 UTSW Mamdc2 0.118 R2016 G1 225 N 19 23334029 D487G T C missense Het probably damaging 0.978 08/25/2014
44 222956 UTSW Mapk8ip1 0.406 R2016 G1 225 N 2 92391034 A G critical splice donor site 2 bp Het probably null phenotype 08/25/2014
45 223054 UTSW Mettl25 0.147 R2016 G1 225 N 10 105797306 E425D T A missense Het probably benign 0.003 08/25/2014
46 223048 UTSW Midn 0.189 R2016 G1 136 N 10 80150115 R13L G T missense Het possibly damaging 0.906 phenotype 08/25/2014
47 223095 UTSW Mtmr9 0.304 R2016 G1 225 N 14 63540264 Y136C T C missense Het possibly damaging 0.588 phenotype 08/25/2014
48 223101 UTSW Mylk 0.000 R2016 G1 225 N 16 34996817 V61M G A missense Het probably damaging 0.999 phenotype 08/25/2014
49 223099 UTSW Nalcn 1.000 R2016 G1 225 N 14 123594581 T C splice site Het probably null phenotype 08/25/2014
50 223068 UTSW Nle1 1.000 R2016 G1 225 N 11 82905547 P166Q G T missense Het probably damaging 1.000 phenotype 08/25/2014
51 222988 UTSW Nr4a3 1.000 R2016 G1 225 N 4 48083252 C595Y G A missense Het probably damaging 1.000 phenotype 08/25/2014
52 222952 UTSW Olfr1133 0.074 R2016 G1 225 N 2 87646052 V24M C T missense Het probably benign 0.182 phenotype 08/25/2014
53 222960 UTSW Olfr1288 0.076 R2016 G1 225 N 2 111479187 M134I G T missense Het probably benign 0.001 phenotype 08/25/2014
54 223093 UTSW Olfr724 0.189 R2016 G1 127 N 14 49960502 I190T A G missense Het probably benign 0.001 phenotype 08/25/2014
55 266043 UTSW Olfr906 0.062 R2016 G1 225 N 9 38488013 A T critical splice acceptor site Het probably null phenotype 02/05/2015
56 223035 UTSW Olfr963 0.062 R2016 G1 225 N 9 39669555 Y166C A G missense Het probably damaging 1.000 phenotype 08/25/2014
57 222998 UTSW Pds5a 1.000 R2016 G1 225 N 5 65648007 T A critical splice acceptor site Het probably null phenotype 08/25/2014
58 223120 UTSW Pitpnm1 0.000 R2016 G1 225 N 19 4111873 V955A T C missense Het probably benign 0.248 phenotype 08/25/2014
59 222964 UTSW Plcb1 0.274 R2016 G1 225 N 2 135362420 I898N T A missense Het possibly damaging 0.937 phenotype 08/25/2014
60 223111 UTSW Plcl2 0.242 R2016 G1 225 N 17 50606694 V244M G A missense Het probably damaging 1.000 phenotype 08/25/2014
61 223025 UTSW Plk1 1.000 R2016 G1 225 N 7 122162440 K257R A G missense Het probably damaging 0.998 phenotype 08/25/2014
62 223006 UTSW Prkcg 0.000 R2016 G1 225 N 7 3323550 T460S A T missense Het probably damaging 0.977 phenotype 08/25/2014
63 223082 UTSW Prl7d1 0.000 R2016 G1 225 N 13 27710173 H138Y G A missense Het probably damaging 0.996 08/25/2014
64 223036 UTSW Prss35 0.080 R2016 G1 225 N 9 86755512 S112G A G missense Het probably benign 0.366 08/25/2014
65 222954 UTSW Ptprj 0.254 R2016 G1 225 N 2 90464614 V417M C T missense Het probably damaging 1.000 phenotype 08/25/2014
66 223027 UTSW Pwwp2b 0.091 R2016 G1 225 N 7 139256151 I503F A T missense Het possibly damaging 0.912 08/25/2014
67 223122 UTSW Rasgrp2 0.000 R2016 G1 225 N 19 6413165 V498A T C missense Het probably benign 0.006 phenotype 08/25/2014
68 223032 UTSW Sall1 0.949 R2016 G1 225 N 8 89028409 V1314A A G missense Het probably benign 0.097 phenotype 08/25/2014
69 222982 UTSW Sema6c 0.290 R2016 G1 225 N 3 95171234 I549V A G missense Het probably benign 0.001 phenotype 08/25/2014
70 223081 UTSW Slc17a1 0.066 R2016 G1 225 N 13 23878539 S230G A G missense Het probably benign 0.034 08/25/2014
71 223046 UTSW Slc5a4a 0.072 R2016 G1 225 N 10 76153580 F106V T G missense Het probably benign 0.003 08/25/2014
72 222976 UTSW Spata5 1.000 R2016 G1 225 N 3 37578762 V839A T C missense Het possibly damaging 0.484 phenotype 08/25/2014
73 223056 UTSW Stat6 0.695 R2016 G1 225 N 10 127650796 L147P T C missense Het probably damaging 1.000 phenotype 08/25/2014
74 223044 UTSW Taar7d 0.099 R2016 G1 225 N 10 24027744 S175T T A missense Het probably benign 0.113 08/25/2014
75 223000 UTSW Tmem132b 0.087 R2016 G1 225 N 5 125623016 Q206R A G missense Het probably benign 0.000 08/25/2014
76 223002 UTSW Tmem229a 0.097 R2016 G1 225 N 6 24955062 D231G T C missense Het probably benign 0.002 08/25/2014
77 223023 UTSW Trim66 0.161 R2016 G1 225 N 7 109472232 A G critical splice donor site 2 bp Het probably null 08/25/2014
78 222949 UTSW Ttc30a1 0.296 R2016 G1 225 N 2 75981457 L94P A G missense Het probably benign 0.416 08/25/2014
79 222966 UTSW Ttll9 0.073 R2016 G1 190 N 2 153002294 E374V A T missense Het probably damaging 0.997 08/25/2014
80 223021 UTSW Vmn2r69 0.090 R2016 G1 225 N 7 85407285 D548E A T missense Het probably damaging 0.984 08/25/2014
81 222941 UTSW Zcchc2 0.344 R2016 G1 225 N 1 106004121 T A unclassified Het probably null 08/25/2014
82 266042 UTSW Zfp282 0.075 R2016 G1 225 N 6 47897787 T A intron Het probably null 02/05/2015
83 222990 UTSW Zfp352 0.000 R2016 G1 225 N 4 90225171 E516G A G missense Het probably benign 0.422 08/25/2014
[records 1 to 83 of 83]