Incidental Mutations

81 incidental mutations are currently displayed, and affect 81 genes.
9 are Possibly Damaging.
33 are Probably Damaging.
24 are Probably Benign.
13 are Probably Null.
2 create premature stop codons.
3 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 81 of 81] per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 230000 UTSW 4930533L02Rik 0.266 R2086 G1 225 Y 7 125318595 M53T T C missense Het unknown 0.087 09/18/2014
2 229967 UTSW Abcb11 0.221 R2086 G1 225 Y 2 69259476 T A splice site Het probably benign phenotype 09/18/2014
3 230034 UTSW Acap2 0.148 R2086 G1 225 Y 16 31110945 A432P C G missense Het probably damaging 1.000 0.968 09/18/2014
4 229978 UTSW Adamtsl1 0.129 R2086 G1 198 Y 4 86228012 R302G A G missense Het probably damaging 0.997 0.377 phenotype 09/18/2014
5 230010 UTSW Ap2b1 1.000 R2086 G1 225 Y 11 83351118 S608A T G missense Het possibly damaging 0.875 0.076 phenotype 09/18/2014
6 230033 UTSW Atp13a3 0.392 R2086 G1 225 Y 16 30352298 T310S T A missense Het possibly damaging 0.893 0.155 phenotype 09/18/2014
7 229988 UTSW Atp6v1b1 0.000 R2086 G1 225 Y 6 83757852 V382A T C missense Het probably benign 0.102 0.090 phenotype 09/18/2014
8 229977 UTSW Atp6v1g1 0.931 R2086 G1 195 Y 4 63550067 F102L T A missense Het probably benign 0.001 0.073 phenotype 09/18/2014
9 230042 UTSW B430306N03Rik 0.082 R2086 G1 225 Y 17 48316782 V37D T A missense Het probably damaging 0.999 0.647 09/18/2014
10 230021 UTSW Cacna1d 0.692 R2086 G1 225 Y 14 30047357 Y1872C T C missense Het possibly damaging 0.830 0.082 phenotype 09/18/2014
11 229965 UTSW Carf 0.000 R2086 G1 225 Y 1 60109411 Y54N T A missense Het probably damaging 1.000 0.494 phenotype 09/18/2014
12 230028 UTSW Cct5 1.000 R2086 G1 225 Y 15 31594203 E256G T C missense Het probably damaging 0.999 0.919 phenotype 09/18/2014
13 230051 UTSW Cd5 0.000 R2086 G1 225 Y 19 10723256 S295P A G missense Het probably benign 0.005 0.090 phenotype 09/18/2014
14 229970 UTSW Cenpb 0.190 R2086 G1 85 Y 2 131178597 T C unclassified Het probably benign 0.089 phenotype 09/18/2014
15 230018 UTSW Cntnap3 0.063 R2086 G1 225 Y 13 64794262 M218T A G missense Het possibly damaging 0.757 0.174 phenotype 09/18/2014
16 230012 UTSW Colec11 0.074 R2086 G1 225 Y 12 28594787 R236H C T missense Het probably damaging 0.985 0.316 phenotype 09/18/2014
17 230046 UTSW Crem 0.298 R2086 G1 225 Y 18 3288098 T A intron Het probably benign phenotype 09/18/2014
18 229971 UTSW Csnk2a1 1.000 R2086 G1 225 Y 2 152254281 N58S A G missense Het probably benign 0.007 0.126 phenotype 09/18/2014
19 229994 UTSW Cyp2a4 0.152 R2086 G1 225 Y 7 26312308 M318R T G missense Het probably damaging 0.996 0.555 09/18/2014
20 230024 UTSW Dhrs1 0.078 R2086 G1 225 Y 14 55743659 Q98L T A missense Het probably null 0.006 0.145 phenotype 09/18/2014
21 230016 UTSW Dnah11 0.527 R2086 G1 225 Y 12 118113871 Q1296K G T missense Het possibly damaging 0.816 0.083 phenotype 09/18/2014
22 229987 UTSW Doxl2 0.000 R2086 G1 225 Y 6 48977602 E558G A G missense Het probably damaging 1.000 0.738 09/18/2014
23 230001 UTSW Edc4 1.000 R2086 G1 225 Y 8 105888002 D105E T A missense Het probably damaging 0.997 0.061 phenotype 09/18/2014
24 229995 UTSW Eid2b 0.197 R2086 G1 225 Y 7 28277773 C T start gained Het probably benign 0.121 09/18/2014
25 229983 UTSW Exoc1 1.000 R2086 G1 225 Y 5 76532846 K28* A T nonsense Het probably null 0.976 phenotype 09/18/2014
26 229982 UTSW Fam114a1 0.000 R2086 G1 200 Y 5 64980059 D115G A G missense Het probably benign 0.387 0.090 09/18/2014
27 229979 UTSW Fam151a 0.000 R2086 G1 221 Y 4 106735563 A T unclassified Het probably null 0.897 09/18/2014
28 229984 UTSW Gc 0.000 R2086 G1 225 Y 5 89438342 Y313C T C missense Het probably damaging 1.000 0.441 phenotype 09/18/2014
29 230011 UTSW Gdpd1 0.118 R2086 G1 225 Y 11 87035268 Y284H A G missense Het probably benign 0.000 0.090 phenotype 09/18/2014
30 229999 UTSW Gm21957 0.472 R2086 G1 225 Y 7 125219706 T A exon Het noncoding transcript 0.087 09/18/2014
31 230017 UTSW Golm1 0.066 R2086 G1 225 Y 13 59645185 Q169* G A nonsense Het probably null 0.975 phenotype 09/18/2014
32 230047 UTSW Greb1l 1.000 R2086 G1 162 Y 18 10523281 V813A T C missense Het probably damaging 0.999 0.199 09/18/2014
33 230022 UTSW Itih1 0.097 R2086 G1 225 Y 14 30937843 A279T C T missense Het probably damaging 1.000 0.574 phenotype 09/18/2014
34 229974 UTSW Kirrel 1.000 R2086 G1 225 Y 3 87089151 M380I C T missense Het probably null 0.461 0.092 phenotype 09/18/2014
35 230045 UTSW Lama1 1.000 R2086 G1 225 Y 17 67817623 C2893R T C missense Het probably damaging 1.000 0.955 phenotype 09/18/2014
36 230048 UTSW Lama3 1.000 R2086 G1 225 Y 18 12524830 N334K T A missense Het probably benign 0.393 0.065 phenotype 09/18/2014
37 230049 UTSW Loxhd1 0.193 R2086 G1 225 Y 18 77384946 D1053G A G missense Het probably damaging 0.999 0.494 phenotype 09/18/2014
38 229968 UTSW Map3k20 0.000 R2086 G1 225 Y 2 72398385 K316R A G missense Het probably benign 0.010 0.070 phenotype 09/18/2014
39 229981 UTSW Mapre3 0.777 R2086 G1 225 Y 5 30863202 A C critical splice acceptor site Het probably null 0.949 phenotype 09/18/2014
40 229985 UTSW Mfsd7a 0.089 R2086 G1 225 Y 5 108445621 R117H C T missense Het probably damaging 1.000 0.351 09/18/2014
41 229986 UTSW Mgam 0.124 R2086 G1 225 Y 6 40761028 T A splice site Het probably null 0.976 phenotype 09/18/2014
42 229997 UTSW Mical2 0.215 R2086 G1 214 Y 7 112318603 H389P A C missense Het probably benign 0.309 0.457 phenotype 09/18/2014
43 230002 UTSW Mtmr2 0.249 R2086 G1 225 Y 9 13799952 D347G A G missense Het probably damaging 1.000 0.973 phenotype 09/18/2014
44 230004 UTSW Nbeal2 0.376 R2086 G1 225 Y 9 110634071 L1309F G A missense Het probably benign 0.085 0.090 phenotype 09/18/2014
45 230020 UTSW Nid2 0.132 R2086 G1 225 Y 14 19778043 G516S G A missense Het probably benign 0.121 0.090 phenotype 09/18/2014
46 230005 UTSW Nodal 1.000 R2086 G1 225 Y 10 61423298 E171D A T missense Het possibly damaging 0.759 0.179 phenotype 09/18/2014
47 229975 UTSW Notch2 1.000 R2086 G1 184 Y 3 98102367 S537P T C missense Het probably damaging 0.997 0.190 phenotype 09/18/2014
48 229993 UTSW Obox6 0.074 R2086 G1 225 Y 7 15833607 L305S A G missense Het probably damaging 0.998 0.647 phenotype 09/18/2014
49 230008 UTSW Obscn 0.817 R2086 G1 225 Y 11 59078256 D2715G T C missense Het probably damaging 0.991 0.312 phenotype 09/18/2014
50 229969 UTSW Olfr154 0.123 R2086 G1 225 Y 2 85663746 S229R A C missense Het probably benign 0.000 0.090 phenotype 09/18/2014
51 230023 UTSW Olfr728 0.202 R2086 G1 225 Y 14 50140123 N172I T A missense Het probably damaging 1.000 0.302 phenotype 09/18/2014
52 230026 UTSW Pcca 1.000 R2086 G1 225 Y 14 122686115 S404P T C missense Het probably damaging 0.987 0.295 phenotype 09/18/2014
53 229972 UTSW Pcdh10 0.237 R2086 G1 225 Y 3 45380471 S407P T C missense Het probably damaging 0.983 0.115 phenotype 09/18/2014
54 229992 UTSW Plekha5 0.230 R2086 G1 225 Y 6 140570318 C A splice site Het probably null 0.976 09/18/2014
55 230019 UTSW Ptdss1 0.000 R2086 G1 225 Y 13 66953555 N72S A G missense Het probably benign 0.004 0.090 phenotype 09/18/2014
56 230044 UTSW Ptprs 1.000 R2086 G1 225 Y 17 56454984 I43V T C missense Het probably null 0.018 0.153 phenotype 09/18/2014
57 230050 UTSW Pygm 0.000 R2086 G1 141 Y 19 6391481 G A critical splice donor site 1 bp Het probably null 0.949 phenotype 09/18/2014
58 229989 UTSW Rab7 0.799 R2086 G1 225 Y 6 88012318 V57I C T missense Het probably benign 0.083 0.256 phenotype 09/18/2014
59 230007 UTSW Rasl10a 0.144 R2086 G1 225 Y 11 5059431 A G critical splice acceptor site Het probably null 0.950 09/18/2014
60 229991 UTSW Rergl 0.106 R2086 G1 225 Y 6 139494834 T106A T C missense Het probably benign 0.000 0.118 09/18/2014
61 230025 UTSW Rnf17 0.584 R2086 G1 225 Y 14 56483380 V1023G T G missense Het probably damaging 0.980 0.558 phenotype 09/18/2014
62 229966 UTSW Rnf25 0.000 R2086 G1 225 Y 1 74593967 R409W T A missense Het probably damaging 0.993 0.073 phenotype 09/18/2014
63 229980 UTSW Rps6ka1 0.000 R2086 G1 180 Y 4 133872969 M1V T C start codon destroyed Het probably null 0.906 phenotype 09/18/2014
64 230014 UTSW Rps6ka5 0.000 R2086 G1 225 Y 12 100619615 T140A T C missense Het possibly damaging 0.665 0.539 phenotype 09/18/2014
65 230006 UTSW Sbno2 0.521 R2086 G1 225 Y 10 80057856 I1204F T A missense Het possibly damaging 0.895 0.543 phenotype 09/18/2014
66 230015 UTSW Serpina16 0.054 R2086 G1 225 Y 12 103675262 I68N A T missense Het probably damaging 0.998 0.647 09/18/2014
67 230036 UTSW Slc35a5 0.193 R2086 G1 225 Y 16 45144265 S202P A G missense Het probably damaging 0.992 0.754 phenotype 09/18/2014
68 230009 UTSW Slc35g3 0.090 R2086 G1 225 Y 11 69760946 S93W G C missense Het probably damaging 1.000 0.381 09/18/2014
69 230030 UTSW Smc1b 0.598 R2086 G1 225 Y 15 85121851 A G splice site Het probably benign 0.090 phenotype 09/18/2014
70 230029 UTSW Spag1 0.650 R2086 G1 225 Y 15 36227141 L648P T C missense Het probably damaging 0.981 0.838 phenotype 09/18/2014
71 230037 UTSW Tagap1 0.000 R2086 G1 225 N 17 6956703 D198G T C missense Het probably benign 0.004 09/18/2014
72 230040 UTSW Tedc2 0.859 R2086 G1 225 Y 17 24217900 E287G T C missense Het probably damaging 1.000 0.356 09/18/2014
73 229996 UTSW Tjp1 1.000 R2086 G1 225 Y 7 65312921 R1089S C A missense Het probably damaging 0.996 0.647 phenotype 09/18/2014
74 229998 UTSW Tnrc6a 0.862 R2086 G1 120 Y 7 123162446 CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT splice site Het probably benign 0.090 phenotype 09/18/2014
75 230031 UTSW Ttc38 0.085 R2086 G1 215 Y 15 85838727 D125E T A missense Het probably benign 0.000 0.090 09/18/2014
76 229964 UTSW Uggt1 0.519 R2086 G1 225 Y 1 36192414 R490Q C T missense Het probably null 1.000 0.616 phenotype 09/18/2014
77 229990 UTSW Uroc1 0.000 R2086 G1 225 Y 6 90344114 L224R T G missense Het probably damaging 1.000 0.511 phenotype 09/18/2014
78 230039 UTSW Vmn1r228 0.074 R2086 G1 225 Y 17 20777193 I21N A T missense Het possibly damaging 0.712 0.179 09/18/2014
79 230038 UTSW Vmn2r102 0.000 R2086 G1 225 Y 17 19676687 L99V T G missense Het probably damaging 1.000 0.647 09/18/2014
80 230003 UTSW Vps13c 0.000 R2086 G1 225 Y 9 67950289 S2601F C T missense Het probably benign 0.291 0.090 phenotype 09/18/2014
81 229976 UTSW Zfp462 0.441 R2086 G1 225 Y 4 55010830 L932P T C missense Het probably damaging 0.998 0.864 phenotype 09/18/2014
[records 1 to 81 of 81]