Incidental Mutations

81 incidental mutations are currently displayed, and affect 81 genes.
9 are Possibly Damaging.
33 are Probably Damaging.
24 are Probably Benign.
13 are Probably Null.
2 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 81 of 81] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 230000 UTSW 4930533L02Rik 0.189 R2086 G1 225 Y 7 125318595 M53T T C missense Het unknown 0.087 09/18/2014
2 229967 UTSW Abcb11 0.795 R2086 G1 225 Y 2 69259476 T A splice site Het probably benign phenotype 09/18/2014
3 230034 UTSW Acap2 0.146 R2086 G1 225 Y 16 31110945 A432P C G missense Het probably damaging 1.000 0.968 09/18/2014
4 229978 UTSW Adamtsl1 0.158 R2086 G1 198 Y 4 86228012 R302G A G missense Het probably damaging 0.997 0.377 phenotype 09/18/2014
5 230010 UTSW Ap2b1 1.000 R2086 G1 225 Y 11 83351118 S608A T G missense Het possibly damaging 0.875 0.076 phenotype 09/18/2014
6 230033 UTSW Atp13a3 0.463 R2086 G1 225 Y 16 30352298 T310S T A missense Het possibly damaging 0.893 0.155 phenotype 09/18/2014
7 229988 UTSW Atp6v1b1 0.000 R2086 G1 225 Y 6 83757852 V382A T C missense Het probably benign 0.102 0.090 phenotype 09/18/2014
8 229977 UTSW Atp6v1g1 0.945 R2086 G1 195 Y 4 63550067 F102L T A missense Het probably benign 0.001 0.073 phenotype 09/18/2014
9 230042 UTSW B430306N03Rik 0.073 R2086 G1 225 Y 17 48316782 V37D T A missense Het probably damaging 0.999 0.647 09/18/2014
10 230021 UTSW Cacna1d 0.829 R2086 G1 225 Y 14 30047357 Y1872C T C missense Het possibly damaging 0.830 0.082 phenotype 09/18/2014
11 229965 UTSW Carf 0.000 R2086 G1 225 Y 1 60109411 Y54N T A missense Het probably damaging 1.000 0.494 phenotype 09/18/2014
12 230028 UTSW Cct5 1.000 R2086 G1 225 Y 15 31594203 E256G T C missense Het probably damaging 0.999 0.919 phenotype 09/18/2014
13 230051 UTSW Cd5 0.000 R2086 G1 225 Y 19 10723256 S295P A G missense Het probably benign 0.005 0.090 phenotype 09/18/2014
14 229970 UTSW Cenpb 0.334 R2086 G1 85 Y 2 131178597 T C unclassified Het probably benign 0.089 phenotype 09/18/2014
15 230018 UTSW Cntnap3 0.056 R2086 G1 225 Y 13 64794262 M218T A G missense Het possibly damaging 0.757 0.174 phenotype 09/18/2014
16 230012 UTSW Colec11 0.058 R2086 G1 225 Y 12 28594787 R236H C T missense Het probably damaging 0.985 0.316 phenotype 09/18/2014
17 230046 UTSW Crem 0.532 R2086 G1 225 Y 18 3288098 T A intron Het probably benign phenotype 09/18/2014
18 229971 UTSW Csnk2a1 1.000 R2086 G1 225 Y 2 152254281 N58S A G missense Het probably benign 0.007 0.126 phenotype 09/18/2014
19 229994 UTSW Cyp2a4 0.076 R2086 G1 225 Y 7 26312308 M318R T G missense Het probably damaging 0.996 0.555 09/18/2014
20 230024 UTSW Dhrs1 0.072 R2086 G1 225 Y 14 55743659 Q98L T A missense Het probably null 0.006 0.145 phenotype 09/18/2014
21 230016 UTSW Dnah11 0.573 R2086 G1 225 Y 12 118113871 Q1296K G T missense Het possibly damaging 0.816 0.083 phenotype 09/18/2014
22 229987 UTSW Doxl2 0.000 R2086 G1 225 Y 6 48977602 E558G A G missense Het probably damaging 1.000 0.738 09/18/2014
23 230001 UTSW Edc4 1.000 R2086 G1 225 Y 8 105888002 D105E T A missense Het probably damaging 0.997 0.061 phenotype 09/18/2014
24 229995 UTSW Eid2b 0.197 R2086 G1 225 Y 7 28277773 C T start gained Het probably benign 0.121 09/18/2014
25 229983 UTSW Exoc1 1.000 R2086 G1 225 Y 5 76532846 K28* A T nonsense Het probably null 0.976 phenotype 09/18/2014
26 229982 UTSW Fam114a1 0.000 R2086 G1 200 Y 5 64980059 D115G A G missense Het probably benign 0.387 0.090 09/18/2014
27 229979 UTSW Fam151a 0.000 R2086 G1 221 Y 4 106735563 A T splice site Het probably null 0.897 09/18/2014
28 229984 UTSW Gc 0.000 R2086 G1 225 Y 5 89438342 Y313C T C missense Het probably damaging 1.000 0.441 phenotype 09/18/2014
29 230011 UTSW Gdpd1 0.168 R2086 G1 225 Y 11 87035268 Y284H A G missense Het probably benign 0.000 0.090 phenotype 09/18/2014
30 229999 UTSW Gm21957 0.313 R2086 G1 225 Y 7 125219706 T A exon Het noncoding transcript 0.087 09/18/2014
31 230017 UTSW Golm1 0.070 R2086 G1 225 Y 13 59645185 Q169* G A nonsense Het probably null 0.975 phenotype 09/18/2014
32 230047 UTSW Greb1l 1.000 R2086 G1 162 Y 18 10523281 V813A T C missense Het probably damaging 0.999 0.199 09/18/2014
33 230022 UTSW Itih1 0.085 R2086 G1 225 Y 14 30937843 A279T C T missense Het probably damaging 1.000 0.574 phenotype 09/18/2014
34 229974 UTSW Kirrel 1.000 R2086 G1 225 Y 3 87089151 M380I C T missense Het probably null 0.461 0.092 phenotype 09/18/2014
35 230045 UTSW Lama1 1.000 R2086 G1 225 Y 17 67817623 C2893R T C missense Het probably damaging 1.000 0.955 phenotype 09/18/2014
36 230048 UTSW Lama3 1.000 R2086 G1 225 Y 18 12524830 N334K T A missense Het probably benign 0.393 0.065 phenotype 09/18/2014
37 230049 UTSW Loxhd1 0.123 R2086 G1 225 Y 18 77384946 D1053G A G missense Het probably damaging 0.999 0.494 phenotype 09/18/2014
38 229968 UTSW Map3k20 0.000 R2086 G1 225 Y 2 72398385 K316R A G missense Het probably benign 0.010 0.070 phenotype 09/18/2014
39 229981 UTSW Mapre3 0.768 R2086 G1 225 Y 5 30863202 A C critical splice acceptor site Het probably null 0.949 phenotype 09/18/2014
40 229985 UTSW Mfsd7a 0.064 R2086 G1 225 Y 5 108445621 R117H C T missense Het probably damaging 1.000 0.351 09/18/2014
41 229986 UTSW Mgam 0.165 R2086 G1 225 Y 6 40761028 T A splice site Het probably null 0.976 phenotype 09/18/2014
42 229997 UTSW Mical2 0.357 R2086 G1 214 Y 7 112318603 H389P A C missense Het probably benign 0.309 0.457 phenotype 09/18/2014
43 230002 UTSW Mtmr2 0.270 R2086 G1 225 Y 9 13799952 D347G A G missense Het probably damaging 1.000 0.973 phenotype 09/18/2014
44 230004 UTSW Nbeal2 0.329 R2086 G1 225 Y 9 110634071 L1309F G A missense Het probably benign 0.085 0.090 phenotype 09/18/2014
45 230020 UTSW Nid2 0.185 R2086 G1 225 Y 14 19778043 G516S G A missense Het probably benign 0.121 0.090 phenotype 09/18/2014
46 230005 UTSW Nodal 1.000 R2086 G1 225 Y 10 61423298 E171D A T missense Het possibly damaging 0.759 0.179 phenotype 09/18/2014
47 229975 UTSW Notch2 1.000 R2086 G1 184 Y 3 98102367 S537P T C missense Het probably damaging 0.997 0.190 phenotype 09/18/2014
48 229993 UTSW Obox6 0.076 R2086 G1 225 Y 7 15833607 L305S A G missense Het probably damaging 0.998 0.647 phenotype 09/18/2014
49 230008 UTSW Obscn 0.795 R2086 G1 225 Y 11 59078256 D2715G T C missense Het probably damaging 0.991 0.312 phenotype 09/18/2014
50 229969 UTSW Olfr154 0.185 R2086 G1 225 Y 2 85663746 S229R A C missense Het probably benign 0.000 0.090 phenotype 09/18/2014
51 230023 UTSW Olfr728 0.186 R2086 G1 225 Y 14 50140123 N172I T A missense Het probably damaging 1.000 0.302 phenotype 09/18/2014
52 230026 UTSW Pcca 1.000 R2086 G1 225 Y 14 122686115 S404P T C missense Het probably damaging 0.987 0.295 phenotype 09/18/2014
53 229972 UTSW Pcdh10 0.283 R2086 G1 225 Y 3 45380471 S407P T C missense Het probably damaging 0.983 0.115 phenotype 09/18/2014
54 229992 UTSW Plekha5 0.220 R2086 G1 225 Y 6 140570318 C A splice site Het probably null 0.976 09/18/2014
55 230019 UTSW Ptdss1 0.000 R2086 G1 225 Y 13 66953555 N72S A G missense Het probably benign 0.004 0.090 phenotype 09/18/2014
56 230044 UTSW Ptprs 1.000 R2086 G1 225 Y 17 56454984 I43V T C missense Het probably null 0.018 0.153 phenotype 09/18/2014
57 230050 UTSW Pygm 0.000 R2086 G1 141 Y 19 6391481 G A critical splice donor site 1 bp Het probably null 0.949 phenotype 09/18/2014
58 229989 UTSW Rab7 0.875 R2086 G1 225 Y 6 88012318 V57I C T missense Het probably benign 0.083 0.256 phenotype 09/18/2014
59 230007 UTSW Rasl10a 0.172 R2086 G1 225 Y 11 5059431 A G critical splice acceptor site Het probably null 0.950 09/18/2014
60 229991 UTSW Rergl 0.089 R2086 G1 225 Y 6 139494834 T106A T C missense Het probably benign 0.000 0.118 09/18/2014
61 230025 UTSW Rnf17 0.497 R2086 G1 225 Y 14 56483380 V1023G T G missense Het probably damaging 0.980 0.558 phenotype 09/18/2014
62 229966 UTSW Rnf25 0.000 R2086 G1 225 Y 1 74593967 R409W T A missense Het probably damaging 0.993 0.073 phenotype 09/18/2014
63 229980 UTSW Rps6ka1 0.000 R2086 G1 180 Y 4 133872969 M1V T C start codon destroyed Het probably null 0.906 phenotype 09/18/2014
64 230014 UTSW Rps6ka5 0.000 R2086 G1 225 Y 12 100619615 T140A T C missense Het possibly damaging 0.665 0.539 phenotype 09/18/2014
65 230006 UTSW Sbno2 0.233 R2086 G1 225 Y 10 80057856 I1204F T A missense Het possibly damaging 0.895 0.543 phenotype 09/18/2014
66 230015 UTSW Serpina16 0.053 R2086 G1 225 Y 12 103675262 I68N A T missense Het probably damaging 0.998 0.647 09/18/2014
67 230036 UTSW Slc35a5 0.150 R2086 G1 225 Y 16 45144265 S202P A G missense Het probably damaging 0.992 0.754 phenotype 09/18/2014
68 230009 UTSW Slc35g3 0.062 R2086 G1 225 Y 11 69760946 S93W G C missense Het probably damaging 1.000 0.381 09/18/2014
69 230030 UTSW Smc1b 0.737 R2086 G1 225 Y 15 85121851 A G splice site Het probably benign 0.090 phenotype 09/18/2014
70 230029 UTSW Spag1 0.731 R2086 G1 225 Y 15 36227141 L648P T C missense Het probably damaging 0.981 0.838 phenotype 09/18/2014
71 230037 UTSW Tagap1 0.000 R2086 G1 225 N 17 6956703 D198G T C missense Het probably benign 0.004 09/18/2014
72 230040 UTSW Tedc2 0.805 R2086 G1 225 Y 17 24217900 E287G T C missense Het probably damaging 1.000 0.356 09/18/2014
73 229996 UTSW Tjp1 1.000 R2086 G1 225 Y 7 65312921 R1089S C A missense Het probably damaging 0.996 0.647 phenotype 09/18/2014
74 229998 UTSW Tnrc6a 0.769 R2086 G1 120 Y 7 123162446 CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT splice site Het probably benign 0.090 phenotype 09/18/2014
75 230031 UTSW Ttc38 0.071 R2086 G1 215 Y 15 85838727 D125E T A missense Het probably benign 0.000 0.090 09/18/2014
76 229964 UTSW Uggt1 0.754 R2086 G1 225 Y 1 36192414 R490Q C T missense Het probably null 1.000 0.616 phenotype 09/18/2014
77 229990 UTSW Uroc1 0.000 R2086 G1 225 Y 6 90344114 L224R T G missense Het probably damaging 1.000 0.511 phenotype 09/18/2014
78 230039 UTSW Vmn1r228 0.075 R2086 G1 225 Y 17 20777193 I21N A T missense Het possibly damaging 0.712 0.179 09/18/2014
79 230038 UTSW Vmn2r102 0.000 R2086 G1 225 Y 17 19676687 L99V T G missense Het probably damaging 1.000 0.647 09/18/2014
80 230003 UTSW Vps13c 0.000 R2086 G1 225 Y 9 67950289 S2601F C T missense Het probably benign 0.291 0.090 phenotype 09/18/2014
81 229976 UTSW Zfp462 0.498 R2086 G1 225 Y 4 55010830 L932P T C missense Het probably damaging 0.998 0.864 phenotype 09/18/2014
[records 1 to 81 of 81]