Incidental Mutations

94 incidental mutations are currently displayed, and affect 94 genes.
16 are Possibly Damaging.
32 are Probably Damaging.
35 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 94 of 94] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 227607 UTSW 4930449I24Rik 0.153 R2127 G1 225 Y 5 146504942 S300T T A missense Het possibly damaging 0.682 0.179 09/17/2014
2 227618 UTSW 4932431P20Rik 0.000 R2127 G1 225 Y 7 29537140 T C exon Het noncoding transcript 0.097 09/17/2014
3 227611 UTSW A2ml1 0.000 R2127 G1 225 Y 6 128558437 V770G A C missense Het probably damaging 1.000 0.647 09/17/2014
4 227651 UTSW Abca6 0.000 R2127 G1 225 Y 11 110219649 I558T A G missense Het probably benign 0.001 0.090 phenotype 09/17/2014
5 227622 UTSW Abhd17c 0.134 R2127 G1 225 Y 7 84110662 G295W C A missense Het probably damaging 1.000 0.917 09/17/2014
6 227680 UTSW Actn3 0.584 R2127 G1 225 Y 19 4871675 A159V G A missense Het probably damaging 1.000 0.171 phenotype 09/17/2014
7 227661 UTSW Adgrv1 0.000 R2127 G1 225 Y 13 81557080 F1537Y A T missense Het probably damaging 1.000 0.571 phenotype 09/17/2014
8 227620 UTSW Agbl1 0.000 R2127 G1 225 Y 7 76419880 V373F G T missense Het possibly damaging 0.642 0.179 phenotype 09/17/2014
9 227681 UTSW Aldh1a1 0.879 R2127 G1 225 Y 19 20642915 E485D A T missense Het probably benign 0.001 0.093 phenotype 09/17/2014
10 227671 UTSW Amdhd2 0.486 R2127 G1 225 Y 17 24158308 A G critical splice donor site 2 bp Het probably null 0.950 09/17/2014
11 227584 UTSW Armc3 0.071 R2127 G1 225 Y 2 19201811 D15G A G missense Het probably damaging 1.000 0.114 phenotype 09/17/2014
12 227610 UTSW Atp2b2 0.827 R2127 G1 225 Y 6 113760650 L921P A G missense Het probably damaging 1.000 0.975 phenotype 09/17/2014
13 227625 UTSW Btbd16 0.000 R2127 G1 225 Y 7 130784308 N88S A G missense Het probably benign 0.171 0.126 phenotype 09/17/2014
14 227583 UTSW Capn10 0.165 R2127 G1 225 Y 1 92938034 C77* T A nonsense Het probably null 0.976 phenotype 09/17/2014
15 227672 UTSW Caskin1 0.158 R2127 G1 225 Y 17 24496996 T C critical splice donor site 2 bp Het probably null 0.949 09/17/2014
16 227598 UTSW Catsper4 0.000 R2127 G1 225 Y 4 134213806 D254G T C missense Het probably benign 0.001 0.090 phenotype 09/17/2014
17 227617 UTSW Catsperg1 0.075 R2127 G1 225 Y 7 29185040 D958G T C missense Het probably damaging 0.999 0.120 09/17/2014
18 227666 UTSW Ccar2 0.545 R2127 G1 225 Y 14 70139651 K787Q T G missense Het probably benign 0.326 0.068 phenotype 09/17/2014
19 227668 UTSW Ccdc191 0.336 R2127 G1 225 Y 16 43908635 T244I C T missense Het probably benign 0.001 0.090 09/17/2014
20 227619 UTSW Cd33 0.000 R2127 G1 225 Y 7 43530275 L243Q A T missense Het possibly damaging 0.716 0.179 phenotype 09/17/2014
21 227631 UTSW Cdc37 0.951 R2127 G1 225 Y 9 21149847 Y4C T C missense Het probably damaging 1.000 0.916 phenotype 09/17/2014
22 227594 UTSW Cenpe 1.000 R2127 G1 225 Y 3 135239780 N1018K T G missense Het probably benign 0.083 0.090 phenotype 09/17/2014
23 227599 UTSW Crocc 0.454 R2127 G1 225 Y 4 141017096 R1830C G A missense Het probably damaging 0.998 0.647 phenotype 09/17/2014
24 227627 UTSW Csmd1 0.000 R2127 G1 225 Y 8 15917392 D3157G T C missense Het probably damaging 0.999 0.264 phenotype 09/17/2014
25 227675 UTSW Dhx57 0.175 R2127 G1 225 Y 17 80273048 V492M C T missense Het probably damaging 1.000 0.647 09/17/2014
26 227645 UTSW Dnah2 0.000 R2127 G1 225 N 11 69458185 I2486N A T missense Het probably benign 0.017 phenotype 09/17/2014
27 227623 UTSW Dnhd1 0.108 R2127 G1 225 Y 7 105693721 T1424I C T missense Het possibly damaging 0.555 0.179 09/17/2014
28 227676 UTSW Dsc3 1.000 R2127 G1 225 Y 18 19968354 A661T C T missense Het probably benign 0.005 0.105 phenotype 09/17/2014
29 227644 UTSW F930015N05Rik 0.196 R2127 G1 225 Y 11 64435403 A G utr 5 prime Het probably benign 0.090 09/17/2014
30 227665 UTSW Fbxo34 0.081 R2127 G1 225 Y 14 47530106 R308S C A missense Het probably damaging 0.977 0.237 phenotype 09/17/2014
31 227638 UTSW Gm10608 0.082 R2127 G1 126 Y 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA small deletion Het probably benign 09/17/2014
32 227649 UTSW Gm11595 0.081 R2127 G1 225 Y 11 99772501 C118S A T missense Het unknown 0.309 09/17/2014
33 227656 UTSW Gm9742 R2127 G1 225 Y 13 8034975 A T unclassified Het noncoding transcript 0.087 09/17/2014
34 227592 UTSW Gmeb2 0.202 R2127 G1 223 Y 2 181259049 A185V G A missense Het probably benign 0.211 0.076 phenotype 09/17/2014
35 227670 UTSW Gpr15 0.000 R2127 G1 225 Y 16 58718255 V157A A G missense Het possibly damaging 0.669 0.179 phenotype 09/17/2014
36 227597 UTSW Gpr3 0.195 R2127 G1 225 Y 4 133210621 A247T C T missense Het probably damaging 0.963 0.154 phenotype 09/17/2014
37 227612 UTSW Grin2b 1.000 R2127 G1 225 Y 6 135778700 S539A A C missense Het probably benign 0.029 0.124 phenotype 09/17/2014
38 227632 UTSW Hmbs 1.000 R2127 G1 225 Y 9 44340707 T92A T C missense Het probably benign 0.085 0.170 phenotype 09/17/2014
39 227582 UTSW Inpp4a 0.213 R2127 G1 225 Y 1 37366919 M173V A G missense Het probably benign 0.084 0.059 phenotype 09/17/2014
40 227659 UTSW Irx4 0.780 R2127 G1 225 Y 13 73265476 S22T T A missense Het probably benign 0.034 0.064 phenotype 09/17/2014
41 227630 UTSW Jph3 0.269 R2127 G1 225 Y 8 121785142 A623V C T missense Het probably benign 0.094 0.090 phenotype 09/17/2014
42 227600 UTSW Kif1b 1.000 R2127 G1 225 Y 4 149187640 S1568L G A missense Het possibly damaging 0.919 0.211 phenotype 09/17/2014
43 227647 UTSW Ksr1 0.154 R2127 G1 225 Y 11 79033313 S361L G A missense Het probably damaging 1.000 0.274 phenotype 09/17/2014
44 227658 UTSW Lyst 0.269 R2127 G1 225 Y 13 13635262 Y506D T G missense Het probably damaging 0.999 0.119 phenotype 09/17/2014
45 227660 UTSW Mctp1 0.000 R2127 G1 225 Y 13 76824822 D648G A G missense Het probably damaging 1.000 0.956 09/17/2014
46 227615 UTSW Megf8 0.930 R2127 G1 225 Y 7 25364582 S2788P T C missense Het possibly damaging 0.734 0.062 phenotype 09/17/2014
47 227654 UTSW Mfsd2b 0.000 R2127 G1 225 Y 12 4867659 Y129F T A missense Het probably benign 0.011 0.194 phenotype 09/17/2014
48 227608 UTSW Mindy4 0.098 R2127 G1 225 Y 6 55218265 S155P T C missense Het probably benign 0.046 0.069 09/17/2014
49 227678 UTSW Mospd4 0.123 R2127 G1 225 Y 18 46465664 A G exon Het noncoding transcript 0.087 09/17/2014
50 227604 UTSW Myo18b 1.000 R2127 G1 225 Y 5 112831078 L1223Q A T missense Het probably damaging 1.000 0.353 phenotype 09/17/2014
51 227637 UTSW Nckipsd 0.319 R2127 G1 225 Y 9 108811733 T156A A G missense Het probably benign 0.000 0.090 phenotype 09/17/2014
52 227679 UTSW Ndst1 1.000 R2127 G1 225 Y 18 60691208 T799I G A missense Het probably benign 0.004 0.333 phenotype 09/17/2014
53 227602 UTSW Npffr2 0.000 R2127 G1 225 Y 5 89568065 I84F A T missense Het probably damaging 1.000 0.209 phenotype 09/17/2014
54 227636 UTSW Nphp3 1.000 R2127 G1 225 Y 9 104008243 V167M G A missense Het probably damaging 0.980 0.073 phenotype 09/17/2014
55 227641 UTSW Nup107 0.961 R2127 G1 225 Y 10 117774475 R354L C A missense Het possibly damaging 0.691 0.899 phenotype 09/17/2014
56 227585 UTSW Olfml2a 0.108 R2127 G1 199 Y 2 38941687 C93R T C missense Het probably damaging 1.000 0.733 09/17/2014
57 227586 UTSW Olfr1145 0.072 R2127 G1 225 Y 2 87810341 I174V A G missense Het probably benign 0.092 0.098 phenotype 09/17/2014
58 227587 UTSW Olfr1157 0.112 R2127 G1 225 Y 2 87962832 V20D A T missense Het probably benign 0.007 0.091 phenotype 09/17/2014
59 227646 UTSW Olfr384 0.270 R2127 G1 225 Y 11 73602805 S75C C G missense Het possibly damaging 0.780 0.147 phenotype 09/17/2014
60 227595 UTSW Pappa 0.647 R2127 G1 225 Y 4 65297257 L1134M T A missense Het probably damaging 1.000 0.647 phenotype 09/17/2014
61 227635 UTSW Plscr4 0.070 R2127 G1 225 Y 9 92488630 F217V T G missense Het possibly damaging 0.820 0.484 09/17/2014
62 227655 UTSW Pnpla8 0.300 R2127 G1 225 Y 12 44308057 Y667N T A missense Het probably benign 0.369 0.125 phenotype 09/17/2014
63 227621 UTSW Polg 1.000 R2127 G1 170 Y 7 79464928 L95P A G missense Het probably damaging 1.000 0.959 phenotype 09/17/2014
64 227614 UTSW Psg20 0.077 R2127 G1 225 Y 7 18682718 I158L T G missense Het probably damaging 0.992 0.476 09/17/2014
65 227643 UTSW Pwwp2a 0.145 R2127 G1 225 Y 11 43705318 S437G A G missense Het probably benign 0.134 0.090 09/17/2014
66 227633 UTSW Rdx 0.000 R2127 G1 225 Y 9 52069732 M305V A G missense Het possibly damaging 0.489 0.344 phenotype 09/17/2014
67 227616 UTSW Rinl 0.000 R2127 G1 225 Y 7 28796743 E383G A G missense Het probably damaging 1.000 0.224 09/17/2014
68 227596 UTSW Ror1 1.000 R2127 G1 225 Y 4 100442093 M888V A G missense Het probably benign 0.000 0.067 phenotype 09/17/2014
69 227639 UTSW Rps12 1.000 R2127 G1 225 Y 10 23786878 I22K A T missense Het possibly damaging 0.746 0.179 phenotype 09/17/2014
70 227593 UTSW Rtca 0.147 R2127 G1 225 Y 3 116497674 R219L C A missense Het possibly damaging 0.845 0.179 phenotype 09/17/2014
71 227657 UTSW Ryr2 1.000 R2127 G1 225 Y 13 11712195 P2427S G A missense Het probably damaging 1.000 0.279 phenotype 09/17/2014
72 227603 UTSW Slc10a6 0.098 R2127 G1 225 Y 5 103609056 Y281H A G missense Het probably benign 0.001 0.090 09/17/2014
73 227652 UTSW Slc39a11 0.119 R2127 G1 225 Y 11 113369803 S176P A G missense Het probably benign 0.000 0.090 09/17/2014
74 227648 UTSW Slfn10-ps 0.064 R2127 G1 225 Y 11 83030342 A G unclassified Het noncoding transcript 0.388 09/17/2014
75 227667 UTSW Spef2 0.162 R2127 G1 225 Y 15 9729661 T124A T C missense Het possibly damaging 0.528 0.098 phenotype 09/17/2014
76 227613 UTSW Sult2a4 0.079 R2127 G1 225 Y 7 13915260 P207Q G T missense Het probably damaging 0.989 0.647 phenotype 09/17/2014
77 227601 UTSW Tas1r3 0.152 R2127 G1 225 Y 4 155860470 R765C G A missense Het probably damaging 0.988 0.484 phenotype 09/17/2014
78 227663 UTSW Tcstv1 0.061 R2127 G1 225 Y 13 119893746 T117A T C missense Het probably damaging 0.983 0.647 09/17/2014
79 227653 UTSW Tha1 0.085 R2127 G1 225 Y 11 117869774 V208A A G missense Het probably damaging 0.983 0.647 09/17/2014
80 227642 UTSW Tmbim4 0.090 R2127 G1 225 Y 10 120224753 I215N T A missense Het probably damaging 1.000 0.938 09/17/2014
81 227634 UTSW Tmem202 0.060 R2127 G1 225 Y 9 59520200 I122F T A missense Het probably benign 0.414 0.090 09/17/2014
82 227669 UTSW Tomm70a 0.966 R2127 G1 225 Y 16 57121871 S4P T C missense Het unknown 0.074 phenotype 09/17/2014
83 227626 UTSW Tpcn2 0.000 R2127 G1 225 Y 7 145273975 A G splice site Het probably benign phenotype 09/17/2014
84 227677 UTSW Trim36 0.264 R2127 G1 225 Y 18 46212337 F10I A T missense Het probably benign 0.272 0.332 phenotype 09/17/2014
85 227605 UTSW Usp30 0.000 R2127 G1 225 Y 5 114111163 E176G A G missense Het probably damaging 1.000 0.774 phenotype 09/17/2014
86 227589 UTSW Usp8 1.000 R2127 G1 225 Y 2 126737575 T G intron 20 bp Het probably null 0.976 phenotype 09/17/2014
87 227609 UTSW Vmn1r32 0.059 R2127 G1 225 Y 6 66553549 Y81F T A missense Het probably benign 0.092 0.090 09/17/2014
88 227628 UTSW Vps36 0.941 R2127 G1 225 Y 8 22218289 G T critical splice donor site 1 bp Het probably null 0.958 phenotype 09/17/2014
89 227650 UTSW Wnt3 1.000 R2127 G1 225 Y 11 103812648 H319R A G missense Het possibly damaging 0.819 0.671 phenotype 09/17/2014
90 227629 UTSW Zfp319 0.145 R2127 G1 225 Y 8 95323763 A T unclassified Het probably benign 0.090 09/17/2014
91 227588 UTSW Zfp408 0.000 R2127 G1 225 Y 2 91645174 E545G T C missense Het probably damaging 0.975 0.166 phenotype 09/17/2014
92 227674 UTSW Zfp799 0.196 R2127 G1 225 Y 17 32819498 R598Q C T missense Het possibly damaging 0.802 0.179 09/17/2014
93 227591 UTSW Zfp831 0.000 R2127 G1 225 Y 2 174648124 V1228A T C missense Het probably benign 0.326 0.074 09/17/2014
94 227640 UTSW Zfp938 0.071 R2127 G1 225 Y 10 82226042 D248G T C missense Het probably benign 0.000 0.090 09/17/2014
[records 1 to 94 of 94]