Incidental Mutations

98 incidental mutations are currently displayed, and affect 96 genes.
17 are Possibly Damaging.
30 are Probably Damaging.
36 are Probably Benign.
13 are Probably Null.
3 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 98 of 98] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 227984 UTSW 2010111I01Rik 0.103 R2130 G1 225 Y 13 63210149 C656S T A missense Het probably benign 0.001 0.090 phenotype 09/17/2014
2 227952 UTSW 9030624J02Rik 0.144 R2130 G1 225 Y 7 118794575 Y516H T C missense Het probably damaging 1.000 0.583 09/17/2014
3 227948 UTSW A2ml1 0.000 R2130 G1 225 Y 6 128576260 N178I T A missense Het probably damaging 0.996 0.647 09/17/2014
4 227928 UTSW Adgrl2 1.000 R2130 G1 225 Y 3 148890488 I71V T C missense Het probably damaging 0.989 0.091 phenotype 09/17/2014
5 227986 UTSW Adgrv1 0.000 R2130 G1 225 Y 13 81581727 T212A T C missense Het possibly damaging 0.611 0.210 phenotype 09/17/2014
6 227895 UTSW Aox3 0.000 R2130 G1 225 Y 1 58169843 H845R A G missense Het probably damaging 0.998 0.647 09/17/2014
7 227965 UTSW Apaf1 1.000 R2130 G1 225 Y 10 91060165 Y348* A T nonsense Het probably null 0.976 phenotype 09/17/2014
8 227954 UTSW Apobr 0.067 R2130 G1 225 Y 7 126587206 T630A A G missense Het probably benign 0.147 0.090 phenotype 09/17/2014
9 227976 UTSW Arhgap23 0.000 R2130 G1 206 Y 11 97451561 D223G A G missense Het possibly damaging 0.771 0.064 phenotype 09/17/2014
10 227996 UTSW Asic1 0.232 R2130 G1 225 Y 15 99671875 T26S A T missense Het possibly damaging 0.732 0.158 phenotype 09/17/2014
11 227932 UTSW Atp13a2 0.000 R2130 G1 225 Y 4 141005016 M864K T A missense Het probably damaging 0.988 0.928 phenotype 09/17/2014
12 228000 UTSW Atrnl1 0.211 R2130 G1 225 Y 19 57654994 G438D G A missense Het probably damaging 0.997 0.181 phenotype 09/17/2014
13 277481 UTSW Bbc3 0.000 R2130 G1 38 Y 7 16312343 V68A T C missense Het possibly damaging 0.511 0.059 phenotype 04/10/2015
14 227997 UTSW Birc6 1.000 R2130 G1 225 Y 17 74659154 T C splice site Het probably benign phenotype 09/17/2014
15 227969 UTSW Btnl9 0.057 R2130 G1 225 Y 11 49180696 F100S A G missense Het probably damaging 0.994 0.837 09/17/2014
16 227962 UTSW Ccpg1 0.000 R2130 G1 225 Y 9 73013158 N685S A G missense Het probably damaging 0.975 0.203 09/17/2014
17 227957 UTSW Ces3b 0.058 R2130 G1 225 Y 8 105092975 T A critical splice donor site 2 bp Het probably null 0.948 09/17/2014
18 227910 UTSW Cfhr2 0.065 R2130 G1 117 N 1 139831155 R52S T G missense Het probably benign 0.413 0.090 09/17/2014
19 227967 UTSW Clhc1 0.067 R2130 G1 225 Y 11 29557663 I126V A G missense Het probably benign 0.329 0.070 09/17/2014
20 227933 UTSW Crocc 0.224 R2130 G1 225 Y 4 141029102 I1071V T C missense Het probably benign 0.036 0.069 phenotype 09/17/2014
21 227925 UTSW Dbt 1.000 R2130 G1 225 Y 3 116539124 D16E T A missense Het probably damaging 0.999 0.198 phenotype 09/17/2014
22 227931 UTSW Dnajc8 1.000 R2130 G1 225 Y 4 132544059 S62P T C missense Het possibly damaging 0.947 0.640 09/17/2014
23 227926 UTSW Dpyd 0.000 R2130 G1 225 Y 3 118674568 V77A T C missense Het probably benign 0.000 0.090 phenotype 09/17/2014
24 227923 UTSW Dram2 0.000 R2130 G1 225 Y 3 106570760 M136K T A missense Het possibly damaging 0.720 0.172 09/17/2014
25 227938 UTSW Dtx2 0.000 R2130 G1 225 Y 5 136012040 F100I T A missense Het probably damaging 0.964 0.105 phenotype 09/17/2014
26 227960 UTSW Dync2h1 1.000 R2130 G1 225 Y 9 7011253 W3654R A T missense Het probably damaging 1.000 0.953 phenotype 09/17/2014
27 227914 UTSW Fam129b 0.241 R2130 G1 225 Y 2 32923647 K624R A G missense Het probably benign 0.345 0.064 09/17/2014
28 227989 UTSW Fam208a 1.000 R2130 G1 225 Y 14 27446388 Y296N T A missense Het probably damaging 1.000 0.334 phenotype 09/17/2014
29 227990 UTSW Fam208a 1.000 R2130 G1 225 Y 14 27476614 N1301S A G missense Het possibly damaging 0.735 0.336 phenotype 09/17/2014
30 227970 UTSW Fbxw10 0.083 R2130 G1 225 Y 11 62859857 I422N T A missense Het probably damaging 0.988 0.647 phenotype 09/17/2014
31 227993 UTSW Fgf17 0.217 R2130 G1 225 Y 14 70638487 R102G T C missense Het probably damaging 0.975 0.279 phenotype 09/17/2014
32 227937 UTSW Gatsl2 0.080 R2130 G1 225 Y 5 134136153 C187Y G A missense Het probably damaging 0.998 0.129 09/17/2014
33 227898 UTSW Gm28040 0.116 R2130 G1 129 Y 1 133327321 AGTG AGTGGCACCTTTGGTG small insertion Het probably benign 09/17/2014
34 227942 UTSW Gm6578 0.000 R2130 G1 225 Y 6 12100187 C A exon Het noncoding transcript 0.087 09/17/2014
35 227919 UTSW Gm8298 0.095 R2130 G1 225 Y 3 59865348 V91A T C missense Het probably damaging 1.000 0.257 09/17/2014
36 227988 UTSW Gm8374 0.103 R2130 G1 134 Y 14 7364194 T49A T C missense Het probably damaging 0.998 0.647 09/17/2014
37 227963 UTSW Gm9797 0.527 R2130 G1 225 Y 10 11609369 G T exon Het noncoding transcript 0.117 09/17/2014
38 227935 UTSW Golga3 0.000 R2130 G1 225 Y 5 110202939 T C critical splice donor site 2 bp Het probably null 0.958 phenotype 09/17/2014
39 227920 UTSW Golim4 0.089 R2130 G1 225 Y 3 75908149 V116D A T missense Het probably damaging 1.000 0.332 phenotype 09/17/2014
40 227908 UTSW Igfn1 0.094 R2130 G1 217 Y 1 135974852 AGGG AGG splice site Het probably benign 09/17/2014
41 227921 UTSW Insrr 0.382 R2130 G1 225 Y 3 87810572 G A splice site 5 bp Het probably null 0.976 phenotype 09/17/2014
42 227905 UTSW Ipo9 1.000 R2130 G1 217 Y 1 135386268 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC small insertion Het probably benign phenotype 09/17/2014
43 227906 UTSW Ipo9 1.000 R2130 G1 225 Y 1 135402250 V484A A G missense Het probably benign 0.000 0.090 phenotype 09/17/2014
44 227950 UTSW Isoc2b 0.157 R2130 G1 225 Y 7 4851439 I31N A T missense Het probably damaging 0.965 0.900 09/17/2014
45 227916 UTSW Kif5c 0.000 R2130 G1 225 Y 2 49758805 T A splice site Het probably benign 0.090 phenotype 09/17/2014
46 227977 UTSW Krtap16-1 0.085 R2130 G1 225 Y 11 99985776 C267* A T nonsense Het probably null 0.976 09/17/2014
47 227912 UTSW Lamc2 0.275 R2130 G1 225 Y 1 153127124 D1037V T A missense Het probably damaging 1.000 0.172 phenotype 09/17/2014
48 227987 UTSW Lhfpl2 0.175 R2130 G1 225 Y 13 94192049 D206G A G missense Het possibly damaging 0.906 0.318 phenotype 09/17/2014
49 227939 UTSW Lmtk2 0.305 R2130 G1 225 Y 5 144174988 T842I C T missense Het possibly damaging 0.605 0.076 phenotype 09/17/2014
50 227981 UTSW Mgat2 0.724 R2130 G1 225 Y 12 69185294 F214S T C missense Het probably damaging 1.000 0.755 phenotype 09/17/2014
51 227955 UTSW Mki67 0.846 R2130 G1 225 Y 7 135704241 T A critical splice acceptor site Het probably null 0.949 phenotype 09/17/2014
52 227974 UTSW Mpo 0.000 R2130 G1 225 Y 11 87797361 D282G A G missense Het possibly damaging 0.897 0.315 phenotype 09/17/2014
53 227971 UTSW Myh10 1.000 R2130 G1 225 Y 11 68807289 A G splice site Het probably benign 0.090 phenotype 09/17/2014
54 227979 UTSW Myo15b 0.072 R2130 G1 225 Y 11 115871643 V1229I G A missense Het probably benign 0.081 0.090 09/17/2014
55 227953 UTSW Nfatc2ip 0.207 R2130 G1 225 Y 7 126390462 V250A A G missense Het probably benign 0.001 0.090 phenotype 09/17/2014
56 227959 UTSW Nrp1 1.000 R2130 G1 225 Y 8 128498516 E782D A T missense Het probably damaging 1.000 0.647 phenotype 09/17/2014
57 227922 UTSW Olfml3 0.000 R2130 G1 225 Y 3 103735869 M399L T A missense Het probably benign 0.055 0.146 phenotype 09/17/2014
58 227915 UTSW Olfr341 0.061 R2130 G1 225 Y 2 36480047 S28P A G missense Het possibly damaging 0.869 0.179 phenotype 09/17/2014
59 227943 UTSW Olfr453 0.112 R2130 G1 225 Y 6 42744135 L33M C A missense Het possibly damaging 0.613 0.179 phenotype 09/17/2014
60 227951 UTSW Olfr683 0.072 R2130 G1 225 Y 7 105143550 I254F T A missense Het probably benign 0.032 0.120 phenotype 09/17/2014
61 227900 UTSW Optc 0.000 R2130 G1 225 Y 1 133903796 A T splice site Het probably null 0.976 phenotype 09/17/2014
62 227897 UTSW Plekha6 0.124 R2130 G1 225 Y 1 133279365 C A intron Het probably null 0.976 09/17/2014
63 227901 UTSW Prelp 0.000 R2130 G1 225 Y 1 133915131 R92K C T missense Het probably benign 0.000 0.090 phenotype 09/17/2014
64 227936 UTSW Psph 1.000 R2130 G1 116 Y 5 129787539 T A unclassified Het probably null 0.887 phenotype 09/17/2014
65 227949 UTSW Ptpro 0.000 R2130 G1 225 Y 6 137411116 A G splice site 3 bp Het probably null 0.976 phenotype 09/17/2014
66 227947 UTSW Pzp 0.130 R2130 G1 225 Y 6 128491161 T C splice site 4 bp Het probably null 0.976 phenotype 09/17/2014
67 227980 UTSW Qrich2 0.077 R2130 G1 225 Y 11 116448417 C T splice site Het probably benign 0.090 09/17/2014
68 277480 UTSW Ren1 1.000 R2130 G1 70 Y 1 133350778 C G unclassified Het probably null 0.225 phenotype 04/10/2015
69 227958 UTSW Rfwd3 0.653 R2130 G1 225 N 8 111297402 V96E A T missense Het probably benign 0.048 phenotype 09/17/2014
70 227992 UTSW Rnf17 0.415 R2130 G1 225 Y 14 56493354 V1205A T C missense Het probably damaging 0.999 0.251 phenotype 09/17/2014
71 227995 UTSW Senp1 1.000 R2130 G1 225 Y 15 98075967 T132S T A missense Het probably benign 0.002 0.090 phenotype 09/17/2014
72 227956 UTSW Sgo2b 0.100 R2130 G1 225 Y 8 63927147 R884G T C missense Het probably benign 0.094 0.090 09/17/2014
73 227918 UTSW Slc10a5 0.092 R2130 G1 225 Y 3 10335218 D127E G T missense Het probably benign 0.000 0.090 09/17/2014
74 227972 UTSW Slc25a35 0.000 R2130 G1 225 Y 11 68968965 S101R T G missense Het possibly damaging 0.878 0.081 phenotype 09/17/2014
75 227945 UTSW Slc6a13 0.237 R2130 G1 225 Y 6 121325041 L194P T C missense Het possibly damaging 0.775 0.179 phenotype 09/17/2014
76 227983 UTSW Snw1 0.959 R2130 G1 225 Y 12 87452703 T G unclassified Het probably benign 0.090 phenotype 09/17/2014
77 227924 UTSW Sort1 0.751 R2130 G1 225 Y 3 108351686 F678Y T A missense Het probably benign 0.000 0.090 phenotype 09/17/2014
78 227929 UTSW Srsf12 0.098 R2130 G1 225 N 4 33225764 C T critical splice acceptor site Het probably benign 09/17/2014
79 228001 UTSW Ssxa1 0.043 R2130 G1 222 Y X 21119342 T A splice site Het probably benign 0.090 09/17/2014
80 227941 UTSW Stard13 0.000 R2130 G1 225 Y 5 151045168 Y879C T C missense Het probably damaging 1.000 0.912 phenotype 09/17/2014
81 227902 UTSW Syt2 0.148 R2130 G1 217 Y 1 134746741 ACTCTCTCT ACTCTCTCTCT splice site Het probably benign phenotype 09/17/2014
82 227927 UTSW Tacr3 0.000 R2130 G1 225 Y 3 134932180 V366A T C missense Het probably benign 0.001 0.093 phenotype 09/17/2014
83 227940 UTSW Tecpr1 0.000 R2130 G1 225 Y 5 144208645 T595S T A missense Het probably benign 0.012 0.060 phenotype 09/17/2014
84 227964 UTSW Tjp3 0.000 R2130 G1 225 Y 10 81278054 M457L T A missense Het possibly damaging 0.524 0.078 phenotype 09/17/2014
85 227998 UTSW Tkfc 0.089 R2130 G1 225 Y 19 10596041 I279T A G missense Het probably damaging 0.972 0.381 phenotype 09/17/2014
86 227973 UTSW Tmem98 1.000 R2130 G1 225 Y 11 80817522 E106G A G missense Het probably damaging 0.999 0.093 phenotype 09/17/2014
87 227907 UTSW Tnnt2 1.000 R2130 G1 217 Y 1 135846761 TG TGG splice site Het probably benign phenotype 09/17/2014
88 227968 UTSW Trim41 0.381 R2130 G1 225 Y 11 48807592 G516W C A missense Het probably damaging 0.999 0.479 phenotype 09/17/2014
89 227911 UTSW Trove2 0.228 R2130 G1 225 Y 1 143760034 D458G T C missense Het probably benign 0.000 0.090 phenotype 09/17/2014
90 227917 UTSW Ttn 1.000 R2130 G1 225 Y 2 76742517 T24265A T C missense Het possibly damaging 0.955 0.089 phenotype 09/17/2014
91 227896 UTSW Usp37 1.000 R2130 G1 225 Y 1 74461656 V582A A G missense Het probably damaging 0.999 0.650 phenotype 09/17/2014
92 227994 UTSW Vps13b 0.000 R2130 G1 225 Y 15 35671400 I1683N T A missense Het probably benign 0.128 0.090 phenotype 09/17/2014
93 227934 UTSW Vps13d 1.000 R2130 G1 211 Y 4 145156101 R968H C T missense Het probably benign 0.166 0.090 phenotype 09/17/2014
94 227946 UTSW Vwf 0.223 R2130 G1 187 Y 6 125657057 T166I C T missense Het probably damaging 1.000 0.407 phenotype 09/17/2014
95 227961 UTSW Zfp280d 0.445 R2130 G1 225 Y 9 72308005 F133L T C missense Het probably damaging 0.999 0.071 09/17/2014
96 227985 UTSW Zfp459 0.000 R2130 G1 225 Y 13 67408276 H229Q A T missense Het probably benign 0.044 0.072 09/17/2014
97 227982 UTSW Zfyve26 0.000 R2130 G1 225 N 12 79268434 I1423F T A missense Het possibly damaging 0.481 phenotype 09/17/2014
98 227913 UTSW Zmynd19 0.000 R2130 G1 225 Y 2 24952636 Y15* T A nonsense Het probably null 0.976 phenotype 09/17/2014
[records 1 to 98 of 98]