Incidental Mutations

124 incidental mutations are currently displayed, and affect 122 genes.
18 are Possibly Damaging.
45 are Probably Damaging.
34 are Probably Benign.
25 are Probably Null.
7 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 124] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 228117 UTSW 2010111I01Rik 0.089 R2131 G1 225 N 13 63210149 C656S T A missense Het probably benign 0.001 0.090 phenotype 09/17/2014
2 228003 UTSW 4931408C20Rik 0.000 R2131 G1 225 N 1 26685854 R82G T C missense Het probably benign 0.111 09/17/2014
3 228088 UTSW 9030624J02Rik 0.158 R2131 G1 225 N 7 118794575 Y516H T C missense Het probably damaging 1.000 0.583 09/17/2014
4 228075 UTSW A2ml1 0.000 R2131 G1 225 N 6 128576260 N178I T A missense Het probably damaging 0.996 0.647 09/17/2014
5 228099 UTSW Acvr2b 1.000 R2131 G1 225 N 9 119432808 R437G A G missense Het probably damaging 1.000 phenotype 09/17/2014
6 228087 UTSW Adamtsl3 0.000 R2131 G1 225 N 7 82578594 A1329E C A missense Het probably damaging 1.000 phenotype 09/17/2014
7 228048 UTSW Adgrl2 1.000 R2131 G1 225 N 3 148890488 I71V T C missense Het probably damaging 0.989 0.091 phenotype 09/17/2014
8 228122 UTSW Adra1a 0.058 R2131 G1 225 N 14 66727532 I324F A T missense Het possibly damaging 0.762 phenotype 09/17/2014
9 228085 UTSW Akap13 1.000 R2131 G1 225 N 7 75611434 A1269S G T missense Het probably benign 0.160 0.090 phenotype 09/17/2014
10 228042 UTSW Ampd1 0.149 R2131 G1 225 N 3 103094878 G T critical splice donor site 1 bp Het probably null phenotype 09/17/2014
11 228023 UTSW Ankrd16 0.087 R2131 G1 225 N 2 11783695 D211E T A missense Het probably damaging 1.000 09/17/2014
12 228006 UTSW Aox3 0.000 R2131 G1 225 N 1 58169843 H845R A G missense Het probably damaging 0.998 0.647 09/17/2014
13 228135 UTSW Apc 0.966 R2131 G1 225 N 18 34312045 Q665K C A missense Het possibly damaging 0.511 phenotype 09/17/2014
14 228060 UTSW Arap2 0.000 R2131 G1 225 N 5 62677958 N747S T C missense Het probably damaging 1.000 phenotype 09/17/2014
15 228118 UTSW Arsk 0.000 R2131 G1 225 N 13 76091812 C47* A T nonsense Het probably null phenotype 09/17/2014
16 228049 UTSW Atp8b5 0.084 R2131 G1 225 N 4 43370726 F1001I T A missense Het probably benign 0.329 09/17/2014
17 228120 UTSW Bap1 1.000 R2131 G1 225 N 14 31258331 Y645* T A nonsense Het probably null phenotype 09/17/2014
18 228070 UTSW Brca2 1.000 R2131 G1 225 N 5 150557129 Y2760C A G missense Het probably damaging 0.997 phenotype 09/17/2014
19 228057 UTSW Cad 0.967 R2131 G1 225 N 5 31058072 F76I T A missense Het probably damaging 1.000 0.423 phenotype 09/17/2014
20 228095 UTSW Capn9 0.061 R2131 G1 225 N 8 124605711 G430R G A missense Het possibly damaging 0.900 0.179 phenotype 09/17/2014
21 228054 UTSW Ccdc27 0.053 R2131 G1 128 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 09/17/2014
22 228052 UTSW Cdkn2c 0.000 R2131 G1 225 N 4 109665063 N28K A C missense Het probably null 0.857 phenotype 09/17/2014
23 228127 UTSW Celsr1 0.819 R2131 G1 225 N 15 85963223 I1438F T A missense Het probably benign 0.348 phenotype 09/17/2014
24 228019 UTSW Cfhr2 0.068 R2131 G1 98 N 1 139831155 R52S T G missense Het probably benign 0.413 0.090 09/17/2014
25 228133 UTSW Cldn1 1.000 R2131 G1 225 N 16 26371550 A26G G C missense Het probably damaging 0.976 phenotype 09/17/2014
26 228036 UTSW Col20a1 0.000 R2131 G1 225 N 2 180992573 F110L T A missense Het probably damaging 1.000 09/17/2014
27 228004 UTSW Creg2 0.073 R2131 G1 225 N 1 39624978 N204S T C missense Het probably benign 0.090 09/17/2014
28 228094 UTSW Cx3cl1 0.000 R2131 G1 225 N 8 94779573 Q69K C A missense Het probably benign 0.034 phenotype 09/17/2014
29 228104 UTSW Cyfip2 1.000 R2131 G1 225 N 11 46286131 E74G T C missense Het possibly damaging 0.780 phenotype 09/17/2014
30 228079 UTSW Cyp2g1 0.000 R2131 G1 225 N 7 26820710 I456F A T missense Het probably damaging 0.992 phenotype 09/17/2014
31 228115 UTSW Dapk1 0.000 R2131 G1 225 N 13 60729531 E528G A G missense Het possibly damaging 0.908 phenotype 09/17/2014
32 228116 UTSW Dapk1 0.000 R2131 G1 225 N 13 60761667 W1365R T A missense Het possibly damaging 0.802 phenotype 09/17/2014
33 228045 UTSW Dbt 1.000 R2131 G1 225 N 3 116539124 D16E T A missense Het probably damaging 0.999 0.198 phenotype 09/17/2014
34 228058 UTSW Depdc5 1.000 R2131 G1 225 N 5 32990781 L1469* T A nonsense Het probably null phenotype 09/17/2014
35 228089 UTSW Dnah3 0.102 R2131 G1 225 N 7 119967759 T2415S T A missense Het possibly damaging 0.925 phenotype 09/17/2014
36 228140 UTSW Dnmbp 0.000 R2131 G1 225 N 19 43854311 L1210S A G missense Het probably damaging 0.998 phenotype 09/17/2014
37 228046 UTSW Dpyd 0.000 R2131 G1 225 N 3 118674568 V77A T C missense Het probably benign 0.000 0.090 phenotype 09/17/2014
38 228093 UTSW Eps15l1 0.226 R2131 G1 225 N 8 72386868 V260D A T missense Het probably benign 0.055 0.090 09/17/2014
39 228002 UTSW Eya1 0.866 R2131 G1 225 N 1 14170974 V573A A G missense Het probably benign 0.162 phenotype 09/17/2014
40 228030 UTSW Fam171b 0.082 R2131 G1 225 N 2 83879858 S625T T A missense Het probably damaging 0.972 09/17/2014
41 228128 UTSW Fam186a 0.063 R2131 G1 225 N 15 99933676 T C unclassified Het probably benign 09/17/2014
42 228119 UTSW Fam208a 1.000 R2131 G1 225 N 14 27476614 N1301S A G missense Het possibly damaging 0.735 0.336 phenotype 09/17/2014
43 228061 UTSW Gabra4 0.000 R2131 G1 225 N 5 71641224 D137E G T missense Het probably benign 0.005 phenotype 09/17/2014
44 228067 UTSW Gatsl2 0.074 R2131 G1 225 N 5 134136153 C187Y G A missense Het probably damaging 0.998 0.129 09/17/2014
45 228108 UTSW Gemin4 0.956 R2131 G1 225 N 11 76211050 P962A G C missense Het probably damaging 1.000 0.155 phenotype 09/17/2014
46 228063 UTSW Gm43302 0.053 R2131 G1 225 N 5 105274744 D474G T C missense Het probably damaging 0.991 09/17/2014
47 228038 UTSW Golim4 0.452 R2131 G1 225 N 3 75908149 V116D A T missense Het probably damaging 1.000 0.332 phenotype 09/17/2014
48 228077 UTSW Gpr19 0.000 R2131 G1 225 N 6 134870442 M1V T C start codon destroyed Het probably null 0.986 phenotype 09/17/2014
49 228035 UTSW Hnf4a 1.000 R2131 G1 225 N 2 163547418 N29K T A missense Het probably benign 0.099 phenotype 09/17/2014
50 228059 UTSW Htt 1.000 R2131 G1 225 N 5 34877109 R1975G A G missense Het possibly damaging 0.500 phenotype 09/17/2014
51 228110 UTSW Ift20 1.000 R2131 G1 225 N 11 78540034 E68K G A missense Het probably damaging 0.995 0.795 phenotype 09/17/2014
52 228081 UTSW Il4i1 0.000 R2131 G1 225 N 7 44840070 V420M G A missense Het probably damaging 0.975 phenotype 09/17/2014
53 228039 UTSW Insrr 0.204 R2131 G1 225 N 3 87810572 G A splice site 5 bp Het probably null 0.976 phenotype 09/17/2014
54 228014 UTSW Ipo9 1.000 R2131 G1 217 N 1 135386268 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC small insertion Het probably benign phenotype 09/17/2014
55 228015 UTSW Ipo9 1.000 R2131 G1 225 N 1 135402250 V484A A G missense Het probably benign 0.000 0.090 phenotype 09/17/2014
56 228106 UTSW Jmjd4 0.118 R2131 G1 225 N 11 59454955 H287L A T missense Het probably damaging 1.000 phenotype 09/17/2014
57 228007 UTSW Kcnj13 1.000 R2131 G1 225 N 1 87386534 V322A A G missense Het probably benign 0.031 0.135 phenotype 09/17/2014
58 228142 UTSW Kdm5d 0.071 R2131 G1 222 N Y 941483 L1228P T C missense Het probably benign 0.022 phenotype 09/17/2014
59 228076 UTSW Klra3 0.050 R2131 G1 225 N 6 130335775 S9P A G missense Het probably benign 0.070 09/17/2014
60 266049 UTSW Ldhd 0.190 R2131 G1 225 N 8 111628537 C T unclassified 2817 bp Het probably null phenotype 02/05/2015
61 228031 UTSW Lmo2 1.000 R2131 G1 225 N 2 103981062 Y147H T C missense Het probably damaging 0.991 0.145 phenotype 09/17/2014
62 228124 UTSW Lmo7 0.264 R2131 G1 225 N 14 101900238 D670V A T missense Het probably damaging 0.989 phenotype 09/17/2014
63 228068 UTSW Lmtk2 0.311 R2131 G1 225 N 5 144174988 T842I C T missense Het possibly damaging 0.605 0.076 phenotype 09/17/2014
64 228137 UTSW Lrp5 0.922 R2131 G1 225 N 19 3622708 T534A T C missense Het possibly damaging 0.870 phenotype 09/17/2014
65 228126 UTSW Lrrc24 0.087 R2131 G1 225 N 15 76715581 F453I A T missense Het possibly damaging 0.917 09/17/2014
66 228084 UTSW Magel2 1.000 R2131 G1 200 N 7 62377738 H130L A T missense Het unknown 0.058 phenotype 09/17/2014
67 228121 UTSW Mcpt8 0.056 R2131 G1 225 N 14 56082283 I237V T C missense Het probably damaging 0.996 phenotype 09/17/2014
68 228123 UTSW Med4 0.959 R2131 G1 225 N 14 73517996 N248S A G missense Het possibly damaging 0.816 phenotype 09/17/2014
69 228072 UTSW Mest 0.187 R2131 G1 225 N 6 30745885 L269F C T missense Het probably damaging 1.000 phenotype 09/17/2014
70 228055 UTSW Mib2 0.000 R2131 G1 225 N 4 155655238 C T unclassified 1705 bp Het probably null phenotype 09/17/2014
71 228091 UTSW Mki67 0.777 R2131 G1 225 N 7 135704241 T A critical splice acceptor site Het probably null 0.949 phenotype 09/17/2014
72 228056 UTSW Mnx1 1.000 R2131 G1 225 N 5 29474189 S299C T A missense Het unknown 0.137 phenotype 09/17/2014
73 228112 UTSW Nbr1 0.000 R2131 G1 225 N 11 101566191 T A unclassified Het probably null phenotype 09/17/2014
74 228097 UTSW Ncapd3 0.960 R2131 G1 225 N 9 27083346 V1174G T G missense Het probably damaging 0.975 phenotype 09/17/2014
75 266048 UTSW Nyap1 0.155 R2131 G1 225 N 5 137733681 A C intron Het probably null phenotype 02/05/2015
76 228043 UTSW Olfml3 0.000 R2131 G1 225 N 3 103735869 M399L T A missense Het probably benign 0.055 0.146 phenotype 09/17/2014
77 228026 UTSW Olfr341 0.060 R2131 G1 225 N 2 36480047 S28P A G missense Het possibly damaging 0.869 0.179 phenotype 09/17/2014
78 228103 UTSW Olfr775 0.076 R2131 G1 225 N 10 129251074 F180S T C missense Het probably benign 0.047 phenotype 09/17/2014
79 228139 UTSW Oosp1 0.125 R2131 G1 225 N 19 11690950 D23G T C missense Het probably damaging 0.977 09/17/2014
80 228011 UTSW Optc 0.000 R2131 G1 225 N 1 133903796 A T splice site Het probably null 0.976 phenotype 09/17/2014
81 228028 UTSW Osbpl6 0.326 R2131 G1 225 N 2 76586214 I546K T A missense Het probably damaging 0.999 0.647 phenotype 09/17/2014
82 228082 UTSW Otog 0.743 R2131 G1 225 N 7 46250100 N275I A T missense Het probably damaging 0.997 phenotype 09/17/2014
83 228136 UTSW Pcdhb14 0.122 R2131 G1 212 N 18 37447870 Q10K C A missense Het probably benign 0.004 09/17/2014
84 228138 UTSW Pcx 1.000 R2131 G1 225 N 19 4602551 F189L T C missense Het probably benign 0.001 phenotype 09/17/2014
85 228064 UTSW Pde6b 0.000 R2131 G1 225 N 5 108428203 D718G A G missense Het probably damaging 0.999 phenotype 09/17/2014
86 228040 UTSW Pklr 0.251 R2131 G1 225 N 3 89142660 P314Q C A missense Het probably damaging 1.000 phenotype 09/17/2014
87 228032 UTSW Plcb1 0.274 R2131 G1 225 N 2 135325667 Y460* T A nonsense Het probably null 0.975 phenotype 09/17/2014
88 228009 UTSW Plekha6 0.122 R2131 G1 225 N 1 133279365 C A intron Het probably null 0.976 09/17/2014
89 228041 UTSW Plekho1 0.125 R2131 G1 225 N 3 95989117 S347P A G missense Het probably damaging 0.997 phenotype 09/17/2014
90 228022 UTSW Plxna2 0.000 R2131 G1 225 N 1 194644750 D331N G A missense Het probably benign 0.006 phenotype 09/17/2014
91 228012 UTSW Prelp 0.000 R2131 G1 225 N 1 133915131 R92K C T missense Het probably benign 0.000 0.090 phenotype 09/17/2014
92 228029 UTSW Prkra 0.596 R2131 G1 225 N 2 76647136 I75K A T missense Het probably damaging 0.997 phenotype 09/17/2014
93 228065 UTSW Ptpn11 1.000 R2131 G1 225 N 5 121172026 A31V G A missense Het probably damaging 0.994 phenotype 09/17/2014
94 228074 UTSW Pzp 0.112 R2131 G1 225 N 6 128491161 T C splice site 4 bp Het probably null 0.976 phenotype 09/17/2014
95 228033 UTSW Rbm12 0.906 R2131 G1 225 N 2 156095510 C947* A T nonsense Het probably null phenotype 09/17/2014
96 228010 UTSW Ren1 1.000 R2131 G1 126 N 1 133350778 C G unclassified Het probably null 0.225 phenotype 09/17/2014
97 228109 UTSW Sarm1 0.194 R2131 G1 225 N 11 78475307 C649S A T missense Het probably benign 0.001 phenotype 09/17/2014
98 228129 UTSW Sept12 0.088 R2131 G1 225 N 16 4991779 Q223L T A missense Het probably damaging 0.999 phenotype 09/17/2014
99 228111 UTSW Sept4 0.729 R2131 G1 225 N 11 87583436 Q60L A T missense Het probably benign 0.262 0.121 phenotype 09/17/2014
100 228105 UTSW Slc22a21 0.000 R2131 G1 225 N 11 53979733 L42Q A T missense Het probably damaging 0.999 phenotype 09/17/2014
[records 1 to 100 of 124] next >> last >|