Incidental Mutations

109 incidental mutations are currently displayed, and affect 106 genes.
15 are Possibly Damaging.
37 are Probably Damaging.
40 are Probably Benign.
16 are Probably Null.
1 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 109] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 236384 UTSW Aagab 0.115 R2142 G1 225 N 9 63616675 T A splice site Het probably null 0.976 phenotype 10/01/2014
2 236308 UTSW Adgrb3 0.363 R2142 G1 225 N 1 25068209 P640T G T missense Het probably damaging 1.000 phenotype 10/01/2014
3 236423 UTSW Adgrf4 0.000 R2142 G1 225 N 17 42666898 R518Q C T missense Het possibly damaging 0.928 0.091 phenotype 10/01/2014
4 236419 UTSW Afdn 1.000 R2142 G1 225 N 17 13810433 E202G A G missense Het probably damaging 0.960 0.078 phenotype 10/01/2014
5 236356 UTSW Alkbh2 0.000 R2142 G1 225 N 5 114125716 V77I C T missense Het probably benign 0.034 0.211 phenotype 10/01/2014
6 236379 UTSW Angpt2 0.726 R2142 G1 225 N 8 18714140 T129A T C missense Het probably benign 0.390 phenotype 10/01/2014
7 236360 UTSW Atp6v0a4 1.000 R2142 G1 225 N 6 38082936 K236* T A nonsense Het probably null phenotype 10/01/2014
8 236357 UTSW Baz1b 1.000 R2142 G1 225 N 5 135217275 R526H G A missense Het probably damaging 0.999 phenotype 10/01/2014
9 236431 UTSW Bscl2 0.000 R2142 G1 225 N 19 8845320 T C splice site 6 bp Het probably null 0.976 phenotype 10/01/2014
10 236393 UTSW Btnl9 0.059 R2142 G1 225 N 11 49170626 G T splice site Het probably null 10/01/2014
11 236312 UTSW Cd55 0.000 R2142 G1 225 N 1 130449423 V333I C T missense Het probably benign 0.316 0.090 phenotype 10/01/2014
12 236381 UTSW Cdh8 0.000 R2142 G1 225 N 8 99111693 C505F C A missense Het probably damaging 1.000 phenotype 10/01/2014
13 236400 UTSW Cep112 0.386 R2142 G1 225 N 11 108606325 E697G A G missense Het probably damaging 0.959 0.064 phenotype 10/01/2014
14 236380 UTSW Ces1c 0.072 R2142 G1 225 N 8 93130840 I38F T A missense Het probably benign 0.000 phenotype 10/01/2014
15 236326 UTSW Cfhr2 0.069 R2142 G1 93 N 1 139831155 R52S T G missense Het probably benign 0.413 0.090 10/01/2014
16 236350 UTSW Clcn6 0.191 R2142 G1 225 N 4 148024137 F145S A G missense Het possibly damaging 0.883 0.338 phenotype 10/01/2014
17 236348 UTSW Cnksr1 0.370 R2142 G1 225 N 4 134229628 Y488H A G missense Het probably damaging 1.000 0.082 phenotype 10/01/2014
18 236329 UTSW Cntrl 0.834 R2142 G1 217 N 2 35122806 CAGAG CAG frame shift Het probably null 0.976 phenotype 10/01/2014
19 236345 UTSW Col25a1 0.183 R2142 G1 225 N 3 130570316 H546R A G missense Het probably damaging 0.998 phenotype 10/01/2014
20 236351 UTSW Crot 0.128 R2142 G1 225 N 5 8987780 Y179N A T missense Het possibly damaging 0.935 phenotype 10/01/2014
21 236354 UTSW Dck 0.000 R2142 G1 225 N 5 88772723 C101R T C missense Het probably damaging 1.000 0.971 phenotype 10/01/2014
22 236432 UTSW Ddb1 1.000 R2142 G1 225 N 19 10619126 T C critical splice donor site 2 bp Het probably null phenotype 10/01/2014
23 236309 UTSW Dnah7b 0.171 R2142 G1 225 N 1 46268670 M3048K T A missense Het probably damaging 1.000 0.386 10/01/2014
24 236311 UTSW Dsel 0.120 R2142 G1 225 N 1 111859457 N1116S T C missense Het probably benign 0.000 0.090 phenotype 10/01/2014
25 236434 UTSW Efnb1 1.000 R2142 G1 222 N X 99147517 Y343C A G missense Het probably damaging 1.000 0.362 phenotype 10/01/2014
26 236340 UTSW Elf2 0.359 R2142 G1 225 N 3 51256440 V496A A G missense Het probably damaging 0.998 10/01/2014
27 236424 UTSW Esco1 0.407 R2142 G1 225 N 18 10574873 A G critical splice donor site 2 bp Het probably null 0.959 phenotype 10/01/2014
28 236337 UTSW Fbn1 0.881 R2142 G1 225 N 2 125412708 T212P T G missense Het possibly damaging 0.931 phenotype 10/01/2014
29 236386 UTSW Fuca2 0.092 R2142 G1 225 N 10 13505865 Y174C A G missense Het probably damaging 1.000 phenotype 10/01/2014
30 236397 UTSW Gabarap 0.000 R2142 G1 160 N 11 69991689 C T unclassified Het probably benign phenotype 10/01/2014
31 236408 UTSW Gdf2 0.000 R2142 G1 225 N 14 33945241 T307A A G missense Het probably benign 0.000 phenotype 10/01/2014
32 236398 UTSW Gemin4 0.956 R2142 G1 225 N 11 76211050 P962A G C missense Het probably damaging 1.000 0.155 phenotype 10/01/2014
33 236422 UTSW Glyatl3 0.000 R2142 G1 225 N 17 40911084 D93G T C missense Het probably benign 0.010 0.102 10/01/2014
34 236403 UTSW Gm266 0.148 R2142 G1 202 N 12 111485181 R197K C T missense Het possibly damaging 0.705 10/01/2014
35 236433 UTSW Gm4907 0.058 R2142 G1 222 N X 23907310 V350E T A missense Het probably benign 0.314 0.070 10/01/2014
36 236390 UTSW Gns 0.291 R2142 G1 189 N 10 121392778 R498H G A missense Het probably damaging 0.999 phenotype 10/01/2014
37 236435 UTSW Gprasp1 0.142 R2142 G1 222 N X 135802042 E995K G A missense Het possibly damaging 0.566 0.162 phenotype 10/01/2014
38 236405 UTSW Grk6 0.000 R2142 G1 220 N 13 55454364 W335R T C missense Het probably damaging 1.000 phenotype 10/01/2014
39 236339 UTSW Helz2 0.000 R2142 G1 225 N 2 181231380 E2379G T C missense Het probably benign 0.000 phenotype 10/01/2014
40 236377 UTSW Hmx2 0.000 R2142 G1 183 N 7 131555859 D234V A T missense Het probably damaging 0.994 phenotype 10/01/2014
41 236399 UTSW Ift20 1.000 R2142 G1 225 N 11 78540034 E68K G A missense Het probably damaging 0.995 0.795 phenotype 10/01/2014
42 236318 UTSW Ipo9 1.000 R2142 G1 217 N 1 135386268 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC small insertion Het probably benign phenotype 10/01/2014
43 236319 UTSW Ipo9 1.000 R2142 G1 214 N 1 135386275 TCC TCCGCC small insertion Het probably benign phenotype 10/01/2014
44 236320 UTSW Ipo9 1.000 R2142 G1 191 N 1 135386282 CCT CCTTCT small insertion Het probably benign phenotype 10/01/2014
45 236321 UTSW Ipo9 1.000 R2142 G1 225 N 1 135402250 V484A A G missense Het probably benign 0.000 0.090 phenotype 10/01/2014
46 236369 UTSW Itpkc 0.350 R2142 G1 225 N 7 27219650 V397A A G missense Het possibly damaging 0.830 phenotype 10/01/2014
47 236404 UTSW Jarid2 1.000 R2142 G1 225 N 13 44906276 N661K T A missense Het probably damaging 0.999 0.330 phenotype 10/01/2014
48 236429 UTSW Kat5 1.000 R2142 G1 225 N 19 5605685 T A critical splice acceptor site Het probably null 0.960 phenotype 10/01/2014
49 236427 UTSW Kctd16 0.140 R2142 G1 225 N 18 40259178 E273G A G missense Het possibly damaging 0.892 0.461 phenotype 10/01/2014
50 236353 UTSW Kdr 1.000 R2142 G1 225 N 5 75968423 T188A T C missense Het possibly damaging 0.561 phenotype 10/01/2014
51 236335 UTSW Kif18a 0.000 R2142 G1 225 N 2 109333503 N732K T A missense Het probably benign 0.425 0.090 phenotype 10/01/2014
52 236413 UTSW Laptm4b 0.090 R2142 G1 225 N 15 34238332 M3I G T missense Het probably benign 0.098 0.072 10/01/2014
53 236347 UTSW Macf1 1.000 R2142 G1 225 N 4 123355102 C7210Y C T missense Het probably damaging 0.999 0.109 phenotype 10/01/2014
54 236388 UTSW Man1a 0.644 R2142 G1 225 N 10 53934998 N338S T C missense Het probably damaging 0.995 phenotype 10/01/2014
55 236364 UTSW Mical3 0.165 R2142 G1 225 N 6 121031134 A T splice site Het probably null 0.976 10/01/2014
56 236415 UTSW Micall1 0.103 R2142 G1 225 N 15 79130795 Y751H T C missense Het probably damaging 0.975 10/01/2014
57 236378 UTSW Mki67 0.811 R2142 G1 225 N 7 135695592 I2571T A G missense Het possibly damaging 0.940 0.179 phenotype 10/01/2014
58 236418 UTSW Mx2 0.220 R2142 G1 205 N 16 97538703 E20K G A missense Het probably benign 0.088 0.090 phenotype 10/01/2014
59 236395 UTSW Myh2 0.250 R2142 G1 225 N 11 67189332 E1124G A G missense Het probably damaging 0.996 phenotype 10/01/2014
60 236412 UTSW Myo10 0.000 R2142 G1 225 N 15 25714108 E87G A G missense Het probably benign 0.000 0.090 phenotype 10/01/2014
61 236334 UTSW Nat10 1.000 R2142 G1 225 N 2 103731303 T C splice site 4 bp Het probably null 0.976 phenotype 10/01/2014
62 236372 UTSW Nipa1 0.000 R2142 G1 225 N 7 55997511 C A splice site 5 bp Het probably null 0.976 phenotype 10/01/2014
63 236352 UTSW Nrbp1 1.000 R2142 G1 225 N 5 31247929 E287G A G missense Het possibly damaging 0.948 phenotype 10/01/2014
64 236328 UTSW Nup188 0.956 R2142 G1 203 N 2 30336706 I1165N T A missense Het possibly damaging 0.491 phenotype 10/01/2014
65 236310 UTSW Obsl1 0.279 R2142 G1 225 N 1 75486756 T1764M G A missense Het probably benign 0.000 0.090 10/01/2014
66 236332 UTSW Olfr1012 0.089 R2142 G1 225 N 2 85759677 R233H C T missense Het probably benign 0.071 phenotype 10/01/2014
67 236421 UTSW Olfr115 0.070 R2142 G1 225 N 17 37610471 E93D T G missense Het probably benign 0.000 0.090 phenotype 10/01/2014
68 236333 UTSW Olfr1240 0.186 R2142 G1 225 N 2 89439583 R232H C T missense Het probably benign 0.003 0.090 phenotype 10/01/2014
69 236336 UTSW Olfr1298 0.185 R2142 G1 225 N 2 111645221 V259L C A missense Het probably benign 0.041 phenotype 10/01/2014
70 236394 UTSW Olfr1383 0.462 R2142 G1 225 N 11 49523839 I39V A G missense Het probably benign 0.001 phenotype 10/01/2014
71 236374 UTSW Olfr642 0.087 R2142 G1 225 N 7 104050300 G18D C T missense Het probably damaging 0.998 phenotype 10/01/2014
72 236391 UTSW Olfr786 0.081 R2142 G1 225 N 10 129437747 K312E A G missense Het probably benign 0.144 phenotype 10/01/2014
73 236314 UTSW Optc 0.000 R2142 G1 225 N 1 133903796 A T splice site Het probably null 0.976 phenotype 10/01/2014
74 236382 UTSW Panx3 0.000 R2142 G1 225 N 9 37666673 S87W G C missense Het probably damaging 1.000 phenotype 10/01/2014
75 236407 UTSW Parp8 0.000 R2142 G1 225 N 13 116894886 D430V T A missense Het probably benign 0.197 0.105 10/01/2014
76 236426 UTSW Pcdhb11 0.114 R2142 G1 225 N 18 37422123 N169D A G missense Het probably benign 0.279 10/01/2014
77 236411 UTSW Pdzd2 0.197 R2142 G1 225 N 15 12406559 G605V C A missense Het probably damaging 1.000 phenotype 10/01/2014
78 236376 UTSW Phkg2 0.421 R2142 G1 225 N 7 127582214 G A critical splice donor site 1 bp Het probably null 0.960 phenotype 10/01/2014
79 236307 UTSW Pkhd1 0.118 R2142 G1 225 N 1 20523895 K1331N T A missense Het probably benign 0.002 phenotype 10/01/2014
80 236338 UTSW Plcb4 0.000 R2142 G1 225 N 2 135976099 V762M G A missense Het probably damaging 1.000 0.266 phenotype 10/01/2014
81 236414 UTSW Plec 0.891 R2142 G1 225 N 15 76183174 T1331A T C missense Het probably benign 0.393 0.089 phenotype 10/01/2014
82 236358 UTSW Pot1a 1.000 R2142 G1 225 N 6 25750044 T C splice site 6 bp Het probably null phenotype 10/01/2014
83 236365 UTSW Prb1 0.063 R2142 G1 225 N 6 132207203 Q489L T A missense Het unknown 10/01/2014
84 236315 UTSW Prelp 0.000 R2142 G1 225 N 1 133915131 R92K C T missense Het probably benign 0.000 0.090 phenotype 10/01/2014
85 236392 UTSW Psme4 0.000 R2142 G1 225 N 11 30820998 Y782C A G missense Het possibly damaging 0.886 phenotype 10/01/2014
86 236363 UTSW Rab11fip5 0.000 R2142 G1 225 N 6 85337228 T C critical splice acceptor site Het probably null phenotype 10/01/2014
87 236313 UTSW Ren1 1.000 R2142 G1 160 N 1 133350778 C G unclassified Het probably null 0.225 phenotype 10/01/2014
88 236425 UTSW Rit2 0.098 R2142 G1 225 N 18 31153713 F140L A G missense Het probably benign 0.004 phenotype 10/01/2014
89 236344 UTSW Rorc 0.866 R2142 G1 225 N 3 94389526 R271Q G A missense Het probably benign 0.043 phenotype 10/01/2014
90 236428 UTSW Sall3 1.000 R2142 G1 168 N 18 80969831 M1130K A T missense Het probably damaging 0.983 phenotype 10/01/2014
91 236355 UTSW Sart3 0.967 R2142 G1 182 N 5 113764093 E141G T C missense Het probably damaging 0.973 phenotype 10/01/2014
92 236402 UTSW Serpina9 0.054 R2142 G1 225 N 12 104008309 D195G T C missense Het probably benign 0.042 10/01/2014
93 236410 UTSW Slitrk6 0.190 R2142 G1 225 N 14 110750794 T494P T G missense Het probably benign 0.003 0.076 phenotype 10/01/2014
94 236373 UTSW Tarsl2 0.111 R2142 G1 225 N 7 65658897 I272L A T missense Het probably benign 0.000 10/01/2014
95 236366 UTSW Tas2r115 0.060 R2142 G1 225 N 6 132737358 K210R T C missense Het probably benign 0.430 0.253 10/01/2014
96 236343 UTSW Tdpoz3 0.838 R2142 G1 225 N 3 93826899 H294Y C T missense Het probably benign 0.018 10/01/2014
97 236341 UTSW Tigd4 0.227 R2142 G1 225 N 3 84594363 T196A A G missense Het possibly damaging 0.954 phenotype 10/01/2014
98 236383 UTSW Treh 0.170 R2142 G1 225 N 9 44681141 M54I G A missense Het probably damaging 0.999 phenotype 10/01/2014
99 236327 UTSW Trove2 0.229 R2142 G1 225 N 1 143760034 D458G T C missense Het probably benign 0.000 0.090 phenotype 10/01/2014
100 236330 UTSW Ttn 1.000 R2142 G1 225 N 2 76813339 G11436R C T missense Het probably damaging 1.000 0.134 phenotype 10/01/2014
[records 1 to 100 of 109] next >> last >|