Incidental Mutations

112 incidental mutations are currently displayed, and affect 110 genes.
14 are Possibly Damaging.
50 are Probably Damaging.
33 are Probably Benign.
13 are Probably Null.
7 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 112] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 236556 UTSW 2310034C09Rik 0.070 R2143 G1 128 N 16 88759165 S89T G C missense Het probably benign 0.000 10/01/2014
2 236482 UTSW 4930522L14Rik 0.084 R2143 G1 225 N 5 109736750 C414S C G missense Het probably damaging 1.000 10/01/2014
3 236472 UTSW 4930553M12Rik 0.087 R2143 G1 225 N 4 88868174 T69I G A missense Het unknown 10/01/2014
4 236473 UTSW 4930553M12Rik 0.087 R2143 G1 225 N 4 88868175 T69S T A missense Het unknown 10/01/2014
5 236502 UTSW Apobr 0.067 R2143 G1 225 N 7 126587116 E600K G A missense Het probably benign 0.015 phenotype 10/01/2014
6 236522 UTSW Armc8 0.629 R2143 G1 225 N 9 99505308 R419L C A missense Het probably damaging 0.986 10/01/2014
7 236463 UTSW Ash1l 1.000 R2143 G1 225 N 3 88985419 M1535K T A missense Het probably benign 0.091 phenotype 10/01/2014
8 236554 UTSW Atf7ip2 0.107 R2143 G1 225 N 16 10240645 E316G A G missense Het probably null 0.682 10/01/2014
9 236501 UTSW Atp2a1 1.000 R2143 G1 225 N 7 126448725 R638* G A nonsense Het probably null phenotype 10/01/2014
10 236537 UTSW Atp5s 0.000 R2143 G1 225 N 12 69741054 Q88R A G missense Het probably damaging 0.972 0.243 phenotype 10/01/2014
11 236456 UTSW Atp8b4 0.063 R2143 G1 225 N 2 126374510 I672N A T missense Het probably damaging 0.996 phenotype 10/01/2014
12 236458 UTSW Atrn 0.000 R2143 G1 225 N 2 130957996 V431A T C missense Het probably benign 0.029 phenotype 10/01/2014
13 236509 UTSW Babam1 0.437 R2143 G1 225 N 8 71398440 S116P T C missense Het probably damaging 0.999 10/01/2014
14 236487 UTSW Ccdc142 0.129 R2143 G1 225 N 6 83102222 L180P T C missense Het probably damaging 1.000 10/01/2014
15 236474 UTSW Cd52 R2143 G1 225 N 4 134093737 T C unclassified Het probably benign phenotype 10/01/2014
16 236527 UTSW Cdk17 0.329 R2143 G1 225 N 10 93218019 L125P T C missense Het probably damaging 0.999 phenotype 10/01/2014
17 236453 UTSW Ckap5 1.000 R2143 G1 225 N 2 91565745 D531G A G missense Het probably benign 0.002 phenotype 10/01/2014
18 236515 UTSW Cntn5 0.000 R2143 G1 225 N 9 9748415 P487Q G T missense Het probably damaging 0.979 0.156 phenotype 10/01/2014
19 236438 UTSW Crispld1 0.121 R2143 G1 225 N 1 17749636 T286I C T missense Het probably benign 0.000 10/01/2014
20 236524 UTSW Crtap 0.120 R2143 G1 225 N 9 114379968 Y336C T C missense Het probably damaging 0.999 phenotype 10/01/2014
21 236514 UTSW Ctu2 1.000 R2143 G1 225 N 8 122479152 I213K T A missense Het probably benign 0.164 0.090 phenotype 10/01/2014
22 236557 UTSW Dsc3 1.000 R2143 G1 225 N 18 19980686 F393S A G missense Het possibly damaging 0.810 phenotype 10/01/2014
23 236558 UTSW Dsg2 0.228 R2143 G1 225 N 18 20579161 I118N T A missense Het probably damaging 0.995 phenotype 10/01/2014
24 236448 UTSW Dstyk 0.222 R2143 G1 225 N 1 132463375 M838K T A missense Het probably damaging 1.000 0.515 phenotype 10/01/2014
25 236512 UTSW Elmo3 0.000 R2143 G1 225 N 8 105308673 V450A T C missense Het probably damaging 1.000 phenotype 10/01/2014
26 236539 UTSW Eml5 0.386 R2143 G1 225 N 12 98810605 F1417C A C missense Het probably damaging 1.000 10/01/2014
27 236480 UTSW Enam 0.722 R2143 G1 225 N 5 88492920 M147K T A missense Het probably benign 0.024 phenotype 10/01/2014
28 236568 UTSW Entpd1 0.000 R2143 G1 225 N 19 40736783 Y409H T C missense Het probably damaging 1.000 phenotype 10/01/2014
29 236475 UTSW Extl1 0.379 R2143 G1 225 N 4 134371044 E225D C A missense Het probably benign 0.305 phenotype 10/01/2014
30 236562 UTSW Fbn2 0.834 R2143 G1 225 N 18 58052993 V1761A A G missense Het possibly damaging 0.655 phenotype 10/01/2014
31 236451 UTSW Fsip2 0.136 R2143 G1 225 N 2 82990271 L5449F A T missense Het possibly damaging 0.931 phenotype 10/01/2014
32 236495 UTSW Gabra5 0.210 R2143 G1 225 N 7 57489015 T95I G A missense Het probably damaging 1.000 phenotype 10/01/2014
33 236444 UTSW Gal3st2c 0.112 R2143 G1 204 N 1 94009451 Q373* C T nonsense Het probably null 10/01/2014
34 236466 UTSW Gbp5 0.000 R2143 G1 225 N 3 142503832 T180P A C missense Het probably damaging 1.000 phenotype 10/01/2014
35 236525 UTSW Glb1 0.000 R2143 G1 225 N 9 114437824 L212P T C missense Het probably damaging 1.000 phenotype 10/01/2014
36 236533 UTSW Gm11596 0.085 R2143 G1 216 N 11 99792963 C110* A T nonsense Het probably null 10/01/2014
37 236457 UTSW Gpat2 0.000 R2143 G1 225 N 2 127433762 F487L T C missense Het probably damaging 1.000 10/01/2014
38 236484 UTSW Hsph1 0.514 R2143 G1 225 N 5 149631486 H110Q A T missense Het probably damaging 0.992 phenotype 10/01/2014
39 236447 UTSW Ikbke 0.000 R2143 G1 225 N 1 131273474 V176L C A missense Het probably damaging 0.978 0.265 phenotype 10/01/2014
40 236449 UTSW Ildr2 0.396 R2143 G1 225 N 1 166269326 V38A T C missense Het probably damaging 0.998 phenotype 10/01/2014
41 236439 UTSW Inpp4a 0.292 R2143 G1 222 N 1 37387746 C326F G T missense Het probably damaging 1.000 phenotype 10/01/2014
42 236489 UTSW Irak2 0.000 R2143 G1 225 N 6 113672827 V141D T A missense Het probably benign 0.034 phenotype 10/01/2014
43 236461 UTSW Jade1 0.000 R2143 G1 225 N 3 41604708 R408Q G A missense Het probably benign 0.000 phenotype 10/01/2014
44 236709 UTSW Jmjd7 0.146 R2143 G1 225 N 2 120030120 C A synonymous Het probably null phenotype 10/01/2014
45 236486 UTSW Kdm7a 0.000 R2143 G1 225 N 6 39168950 V348I C T missense Het possibly damaging 0.613 phenotype 10/01/2014
46 236560 UTSW Kif20a 1.000 R2143 G1 225 N 18 34625604 D42G A G missense Het possibly damaging 0.545 10/01/2014
47 236477 UTSW Klhl7 0.245 R2143 G1 132 N 5 24100863 M37L A T missense Het probably benign 0.000 phenotype 10/01/2014
48 236553 UTSW Krt5 1.000 R2143 G1 225 N 15 101712359 I151T A G missense Het probably damaging 0.998 phenotype 10/01/2014
49 236532 UTSW Krtap1-5 R2143 G1 225 N 11 99580818 I50V T C missense Het probably benign 0.061 10/01/2014
50 236479 UTSW Letm1 0.960 R2143 G1 217 N 5 33769515 A AG frame shift Het probably null 0.976 phenotype 10/01/2014
51 236462 UTSW Lrrc71 0.000 R2143 G1 225 N 3 87745521 W148* C T nonsense Het probably null 10/01/2014
52 236535 UTSW Lsmem1 0.082 R2143 G1 192 N 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 10/01/2014
53 236455 UTSW Map1a 0.342 R2143 G1 178 N 2 121301945 S843T T A missense Het probably damaging 1.000 phenotype 10/01/2014
54 236508 UTSW Map1s 0.000 R2143 G1 225 N 8 70910964 D48E T A missense Het probably damaging 0.998 phenotype 10/01/2014
55 236544 UTSW Mast4 0.393 R2143 G1 225 N 13 102735475 F2462L A G missense Het possibly damaging 0.892 phenotype 10/01/2014
56 236440 UTSW Mettl21e 0.082 R2143 G1 225 N 1 44210238 Y86F T A missense Het probably benign 0.057 10/01/2014
57 236547 UTSW Myh6 1.000 R2143 G1 225 N 14 54952954 D1035E A T missense Het probably damaging 0.999 phenotype 10/01/2014
58 236543 UTSW Naip6 0.157 R2143 G1 225 N 13 100299859 D719N C T missense Het probably damaging 0.999 phenotype 10/01/2014
59 236488 UTSW Nat8f2 0.000 R2143 G1 225 N 6 85868257 H41P T G missense Het probably benign 0.001 10/01/2014
60 236518 UTSW Ncam1 0.909 R2143 G1 225 N 9 49543019 Q597L T A missense Het possibly damaging 0.871 phenotype 10/01/2014
61 236505 UTSW Nek1 0.000 R2143 G1 225 N 8 61028696 I215K T A missense Het probably damaging 1.000 phenotype 10/01/2014
62 236534 UTSW Nol11 0.933 R2143 G1 225 N 11 107181055 S237R A T missense Het probably benign 0.026 10/01/2014
63 236469 UTSW Npr2 0.734 R2143 G1 225 N 4 43648166 F870S T C missense Het probably damaging 1.000 phenotype 10/01/2014
64 236541 UTSW Nsd1 1.000 R2143 G1 225 N 13 55260397 Y1285H T C missense Het probably damaging 1.000 phenotype 10/01/2014
65 236511 UTSW Nup93 0.924 R2143 G1 225 N 8 94296480 Q229* C T nonsense Het probably null phenotype 10/01/2014
66 236452 UTSW Olfr1234 0.113 R2143 G1 225 N 2 89363103 E109K C T missense Het probably damaging 0.999 phenotype 10/01/2014
67 236516 UTSW Olfr834 0.634 R2143 G1 225 N 9 18988803 A272T G A missense Het probably benign 0.056 phenotype 10/01/2014
68 236471 UTSW Pappa 0.680 R2143 G1 225 N 4 65180949 Y568* T A nonsense Het probably null phenotype 10/01/2014
69 236500 UTSW Parva 1.000 R2143 G1 225 N 7 112560067 D180G A G missense Het possibly damaging 0.831 phenotype 10/01/2014
70 236443 UTSW Pask 0.117 R2143 G1 225 N 1 93321297 A794T C T missense Het probably benign 0.004 0.079 phenotype 10/01/2014
71 236459 UTSW Pax1 0.472 R2143 G1 225 N 2 147365882 C225S T A missense Het probably damaging 1.000 phenotype 10/01/2014
72 236465 UTSW Pde4dip 1.000 R2143 G1 109 N 3 97888519 E51V T A missense Het possibly damaging 0.861 phenotype 10/01/2014
73 236567 UTSW Pde6c 0.210 R2143 G1 225 N 19 38162329 H562L A T missense Het probably damaging 1.000 phenotype 10/01/2014
74 236503 UTSW Pet100 0.418 R2143 G1 225 N 8 3622355 L14R T G missense Het probably damaging 1.000 phenotype 10/01/2014
75 236446 UTSW Pfkfb2 0.000 R2143 G1 225 N 1 130698723 T438A T C missense Het probably benign 0.005 0.090 phenotype 10/01/2014
76 236491 UTSW Pira2 0.077 R2143 G1 225 N 7 3844345 L115Q A T missense Het probably damaging 1.000 0.303 10/01/2014
77 236559 UTSW Polr2d R2143 G1 143 N 18 31796079 L127Q T A missense Het probably damaging 1.000 phenotype 10/01/2014
78 236536 UTSW Prkd1 1.000 R2143 G1 225 N 12 50489911 V130A A G missense Het possibly damaging 0.766 0.273 phenotype 10/01/2014
79 236506 UTSW Psd3 0.102 R2143 G1 190 N 8 67964351 D45G T C missense Het probably damaging 1.000 10/01/2014
80 236481 UTSW Ptpn13 0.228 R2143 G1 225 N 5 103556133 T1344A A G missense Het probably benign 0.000 0.059 phenotype 10/01/2014
81 236490 UTSW Ptpn6 0.549 R2143 G1 225 N 6 124724984 H406L T A missense Het probably benign 0.006 phenotype 10/01/2014
82 236565 UTSW Ric1 0.415 R2143 G1 119 N 19 29533252 S78C A T missense Het probably damaging 0.998 10/01/2014
83 236566 UTSW Ric1 0.415 R2143 G1 124 N 19 29533253 S78N G A missense Het probably damaging 0.965 10/01/2014
84 236493 UTSW Scgb1b2 0.056 R2143 G1 225 N 7 31291763 G T intron Het probably benign 0.090 10/01/2014
85 236555 UTSW Senp7 0.256 R2143 G1 225 N 16 56169806 H639R A G missense Het probably benign 0.000 phenotype 10/01/2014
86 236545 UTSW Sgtb 0.266 R2143 G1 225 N 13 104124259 D72V A T missense Het probably damaging 0.997 10/01/2014
87 236467 UTSW Slc44a5 0.080 R2143 G1 225 N 3 154258449 M484T T C missense Het probably benign 0.013 10/01/2014
88 236478 UTSW Slc5a1 0.157 R2143 G1 225 N 5 33160796 K598E A G missense Het probably benign 0.000 phenotype 10/01/2014
89 236529 UTSW Slit3 0.894 R2143 G1 225 N 11 35612261 T A splice site Het probably null phenotype 10/01/2014
90 236552 UTSW Smc1b 0.568 R2143 G1 225 N 15 85123802 H258R T C missense Het probably benign 0.000 phenotype 10/01/2014
91 236468 UTSW Smu1 0.954 R2143 G1 225 N 4 40744073 D318G T C missense Het probably damaging 0.990 10/01/2014
92 236442 UTSW Sned1 0.101 R2143 G1 225 N 1 93271684 F495L T A missense Het probably damaging 0.996 10/01/2014
93 236460 UTSW Svs3a 0.117 R2143 G1 225 N 2 164289884 S124Y C A missense Het probably damaging 0.988 phenotype 10/01/2014
94 236494 UTSW Syngr4 0.077 R2143 G1 225 N 7 45887040 V186A A G missense Het probably benign 0.012 0.080 phenotype 10/01/2014
95 236496 UTSW Tarsl2 0.163 R2143 G1 225 N 7 65655791 M254I G A missense Het possibly damaging 0.568 0.203 10/01/2014
96 236464 UTSW Tdpoz1 0.856 R2143 G1 225 N 3 93670836 R214* T A nonsense Het probably null 10/01/2014
97 236497 UTSW Tm2d3 1.000 R2143 G1 225 N 7 65695239 D54G A G missense Het probably damaging 0.998 phenotype 10/01/2014
98 236499 UTSW Trim66 0.283 R2143 G1 225 N 7 109475113 I647N A T missense Het probably damaging 0.981 0.090 10/01/2014
99 236504 UTSW Triml2 0.069 R2143 G1 225 N 8 43193511 W346R T A missense Het probably damaging 1.000 phenotype 10/01/2014
100 236454 UTSW Trp53bp1 0.000 R2143 G1 225 N 2 121216064 V1085D A T missense Het probably benign 0.002 phenotype 10/01/2014
[records 1 to 100 of 112] next >> last >|