Incidental Mutations

105 incidental mutations are currently displayed, and affect 105 genes.
17 are Possibly Damaging.
36 are Probably Damaging.
45 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 105] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 233743 UTSW 1110032A03Rik 0.000 R2145 G1 225 Y 9 50764874 Y32C T C missense Het probably damaging 0.998 0.647 10/01/2014
2 233734 UTSW Abca15 0.062 R2145 G1 225 Y 7 120354478 N535S A G missense Het probably benign 0.078 0.063 10/01/2014
3 233728 UTSW Abcc6 0.779 R2145 G1 225 Y 7 45998741 L717Q A T missense Het probably benign 0.012 0.090 phenotype 10/01/2014
4 233735 UTSW Abraxas2 0.000 R2145 G1 225 Y 7 132883061 Q278K C A missense Het probably benign 0.270 0.099 10/01/2014
5 233777 UTSW Acap2 0.126 R2145 G1 225 Y 16 31105524 D637E A T missense Het probably benign 0.000 0.090 10/01/2014
6 233783 UTSW AI661453 0.074 R2145 G1 225 Y 17 47466098 A G intron Het probably benign 0.090 10/01/2014
7 233764 UTSW Aoah 0.000 R2145 G1 225 Y 13 20840096 E74V A T missense Het probably damaging 0.999 0.146 phenotype 10/01/2014
8 233769 UTSW Appl1 0.168 R2145 G1 225 Y 14 26949619 L292S A G missense Het possibly damaging 0.659 0.413 phenotype 10/01/2014
9 233705 UTSW Astl 0.098 R2145 G1 225 Y 2 127347189 V166E T A missense Het probably damaging 1.000 0.647 phenotype 10/01/2014
10 233763 UTSW Atp5s 0.000 R2145 G1 225 Y 12 69741054 Q88R A G missense Het probably damaging 0.972 0.243 phenotype 10/01/2014
11 233786 UTSW Bbs1 0.799 R2145 G1 225 Y 19 4903707 K143Q T G missense Het possibly damaging 0.715 0.079 phenotype 10/01/2014
12 233779 UTSW Bbx 0.000 R2145 G1 225 Y 16 50274544 T C splice site Het probably benign phenotype 10/01/2014
13 233784 UTSW Birc6 1.000 R2145 G1 225 Y 17 74660413 Q4103L A T missense Het possibly damaging 0.712 0.076 phenotype 10/01/2014
14 233750 UTSW C1qtnf2 0.000 R2145 G1 225 Y 11 43490984 F178V T G missense Het probably damaging 1.000 0.321 10/01/2014
15 233754 UTSW Camta2 0.558 R2145 G1 225 Y 11 70671575 F999L A G missense Het probably benign 0.313 0.165 phenotype 10/01/2014
16 233781 UTSW Clcn7 1.000 R2145 G1 225 Y 17 25144451 I34V A G missense Het probably benign 0.000 0.090 phenotype 10/01/2014
17 233740 UTSW Cntn5 0.000 R2145 G1 225 Y 9 9748415 P487Q G T missense Het probably damaging 0.979 0.156 phenotype 10/01/2014
18 233739 UTSW Ctu2 1.000 R2145 G1 225 Y 8 122479152 I213K T A missense Het probably benign 0.164 0.090 phenotype 10/01/2014
19 233684 UTSW Des 0.429 R2145 G1 225 Y 1 75363464 C A splice site Het probably benign phenotype 10/01/2014
20 233776 UTSW Dgcr8 1.000 R2145 G1 225 Y 16 18280230 D432E A T missense Het probably benign 0.257 0.081 phenotype 10/01/2014
21 233770 UTSW Dlgap5 0.861 R2145 G1 225 Y 14 47395923 R549* G A nonsense Het probably null 0.976 phenotype 10/01/2014
22 233744 UTSW Dmxl2 1.000 R2145 G1 225 Y 9 54415910 T1397A T C missense Het probably damaging 0.999 0.226 phenotype 10/01/2014
23 233741 UTSW Dnmt1 1.000 R2145 G1 225 Y 9 20937155 T A splice site Het probably benign phenotype 10/01/2014
24 233721 UTSW Doxl2 0.000 R2145 G1 225 Y 6 48976695 D518V A T missense Het probably damaging 1.000 0.647 10/01/2014
25 233689 UTSW Dstyk 0.197 R2145 G1 225 Y 1 132463375 M838K T A missense Het probably damaging 1.000 0.515 phenotype 10/01/2014
26 233704 UTSW Dtwd1 0.000 R2145 G1 225 Y 2 126159984 T208N C A missense Het probably damaging 1.000 0.879 10/01/2014
27 233714 UTSW Dvl1 0.000 R2145 G1 122 Y 4 155847816 V28I G A missense Het possibly damaging 0.837 0.075 phenotype 10/01/2014
28 233700 UTSW Dync1i2 0.969 R2145 G1 225 Y 2 71214563 T A splice site Het probably benign phenotype 10/01/2014
29 233773 UTSW Fer1l6 0.081 R2145 G1 225 Y 15 58627534 M1251K T A missense Het probably benign 0.000 0.090 10/01/2014
30 233690 UTSW Fmod 0.395 R2145 G1 225 Y 1 134040518 Y99H T C missense Het probably benign 0.177 0.073 phenotype 10/01/2014
31 233683 UTSW Fn1 1.000 R2145 G1 225 Y 1 71606004 V1552D A T missense Het probably damaging 1.000 0.855 phenotype 10/01/2014
32 233709 UTSW Fnip2 0.000 R2145 G1 225 Y 3 79500432 S281T A T missense Het probably damaging 0.993 0.096 phenotype 10/01/2014
33 233748 UTSW Glb1 0.000 R2145 G1 225 Y 9 114464165 H536R A G missense Het probably benign 0.001 0.061 phenotype 10/01/2014
34 233774 UTSW Glis2 0.908 R2145 G1 225 Y 16 4613642 S344R T A missense Het possibly damaging 0.789 0.179 phenotype 10/01/2014
35 233732 UTSW Gm1966 0.099 R2145 G1 225 Y 7 106603008 H343L T A missense Het possibly damaging 0.844 0.179 10/01/2014
36 233694 UTSW Gm4847 0.093 R2145 G1 225 Y 1 166634903 S339R A T missense Het probably benign 0.004 0.090 10/01/2014
37 233701 UTSW Gpr155 0.000 R2145 G1 225 Y 2 73356658 S44P A G missense Het probably benign 0.006 0.065 10/01/2014
38 233766 UTSW Gprin1 0.000 R2145 G1 225 Y 13 54738632 P610S G A missense Het probably damaging 0.992 0.085 10/01/2014
39 233782 UTSW H2-Ob 0.057 R2145 G1 225 Y 17 34242580 M98L A T missense Het probably benign 0.003 0.138 phenotype 10/01/2014
40 314428 UTSW Hist1h3e 0.173 R2145 G1 41 Y 13 23562356 T4A T C missense Het probably benign 0.000 0.095 phenotype 05/06/2015
41 233697 UTSW Hmcn2 0.000 R2145 G1 225 Y 2 31333931 T C splice site Het probably benign 0.090 10/01/2014
42 233688 UTSW Ikbke 0.000 R2145 G1 225 Y 1 131273474 V176L C A missense Het probably damaging 0.978 0.265 phenotype 10/01/2014
43 233751 UTSW Il13 0.000 R2145 G1 225 Y 11 53632524 T85A T C missense Het possibly damaging 0.824 0.205 phenotype 10/01/2014
44 233756 UTSW Inpp5k 1.000 R2145 G1 225 Y 11 75647191 A T critical splice acceptor site Het probably null 0.949 phenotype 10/01/2014
45 233752 UTSW Irgm2 0.000 R2145 G1 225 Y 11 58220529 S361P T C missense Het possibly damaging 0.900 0.179 phenotype 10/01/2014
46 233745 UTSW Itga11 0.091 R2145 G1 163 Y 9 62732204 C T splice site Het probably benign phenotype 10/01/2014
47 233778 UTSW Kalrn 0.933 R2145 G1 225 Y 16 34009262 G T unclassified Het probably benign phenotype 10/01/2014
48 233707 UTSW Kcng1 0.180 R2145 G1 225 Y 2 168269032 G71C C A missense Het probably damaging 1.000 0.971 phenotype 10/01/2014
49 233681 UTSW Kcnq5 0.197 R2145 G1 225 Y 1 21505349 D291V T A missense Het probably damaging 0.957 0.756 phenotype 10/01/2014
50 233715 UTSW Klhl7 0.198 R2145 G1 174 N 5 24100863 M37L A T missense Het probably benign 0.000 phenotype 10/01/2014
51 233716 UTSW Letm1 0.961 R2145 G1 217 Y 5 33769515 A AG frame shift Het probably null 0.976 phenotype 10/01/2014
52 233698 UTSW Lhx6 0.946 R2145 G1 225 Y 2 36087466 V325I C T missense Het probably benign 0.007 0.107 phenotype 10/01/2014
53 233747 UTSW Lipc 0.091 R2145 G1 225 Y 9 70934535 I9T A G missense Het possibly damaging 0.942 0.195 phenotype 10/01/2014
54 233761 UTSW Lsmem1 0.070 R2145 G1 155 Y 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 10/01/2014
55 233736 UTSW Mast1 0.000 R2145 G1 225 Y 8 84921478 G458V C A missense Het probably damaging 1.000 0.954 10/01/2014
56 233702 UTSW Mga 0.936 R2145 G1 225 Y 2 119964157 V2565A T C missense Het possibly damaging 0.845 0.107 phenotype 10/01/2014
57 233775 UTSW Mkl2 1.000 R2145 G1 225 Y 16 13412586 I1045T T C missense Het probably damaging 0.981 0.128 phenotype 10/01/2014
58 233742 UTSW Mpzl2 0.000 R2145 G1 225 Y 9 45044173 D127E C G missense Het probably benign 0.013 0.090 phenotype 10/01/2014
59 233753 UTSW Myh3 0.616 R2145 G1 225 Y 11 67091056 C793S T A missense Het probably benign 0.000 0.071 phenotype 10/01/2014
60 233729 UTSW Nomo1 0.723 R2145 G1 225 Y 7 46066504 L765P T C missense Het probably damaging 1.000 0.751 10/01/2014
61 233722 UTSW Nup210 0.000 R2145 G1 225 N 6 91028876 I1335T A G missense Het possibly damaging 0.807 phenotype 10/01/2014
62 233731 UTSW Olfr549 0.068 R2145 G1 225 Y 7 102555060 T C splice site 2862 bp Het probably null 0.976 phenotype 10/01/2014
63 233772 UTSW Oxr1 0.000 R2145 G1 225 Y 15 41819944 S254R T A missense Het probably damaging 1.000 0.107 phenotype 10/01/2014
64 233720 UTSW Pan3 0.486 R2145 G1 225 Y 5 147530098 I592V A G missense Het possibly damaging 0.872 0.197 10/01/2014
65 233686 UTSW Pask 0.086 R2145 G1 225 Y 1 93321297 A794T C T missense Het probably benign 0.004 0.079 phenotype 10/01/2014
66 233708 UTSW Pex2 1.000 R2145 G1 225 Y 3 5561590 E53G T C missense Het probably damaging 1.000 0.624 phenotype 10/01/2014
67 233687 UTSW Pfkfb2 0.000 R2145 G1 225 Y 1 130698723 T438A T C missense Het probably benign 0.005 0.090 phenotype 10/01/2014
68 233712 UTSW Phactr4 1.000 R2145 G1 225 Y 4 132370784 E391G T C missense Het probably damaging 0.976 0.064 phenotype 10/01/2014
69 233724 UTSW Pira2 0.065 R2145 G1 225 Y 7 3844345 L115Q A T missense Het probably damaging 1.000 0.303 10/01/2014
70 266063 UTSW Pkhd1l1 0.000 R2145 G1 225 N 15 44512877 A T splice site Het probably null 02/05/2015
71 233787 UTSW Pnlip 0.139 R2145 G1 225 Y 19 58676444 S235G A G missense Het probably benign 0.110 0.206 phenotype 10/01/2014
72 233762 UTSW Prkd1 1.000 R2145 G1 225 Y 12 50489911 V130A A G missense Het possibly damaging 0.766 0.273 phenotype 10/01/2014
73 233717 UTSW Ptpn13 0.244 R2145 G1 225 Y 5 103556133 T1344A A G missense Het probably benign 0.000 0.059 phenotype 10/01/2014
74 233691 UTSW Ptprc 0.000 R2145 G1 225 Y 1 138073681 Y780C T C missense Het probably damaging 1.000 0.492 phenotype 10/01/2014
75 233718 UTSW Pxn 1.000 R2145 G1 225 Y 5 115552756 T A unclassified Het probably benign phenotype 10/01/2014
76 233755 UTSW Rap1gap2 0.623 R2145 G1 225 Y 11 74425976 T245M G A missense Het probably damaging 0.999 0.095 phenotype 10/01/2014
77 233692 UTSW Rc3h1 0.309 R2145 G1 225 Y 1 160930257 K48N G T missense Het probably damaging 0.998 0.151 phenotype 10/01/2014
78 233738 UTSW Rfwd3 0.537 R2145 G1 225 Y 8 111282613 I444V T C missense Het probably benign 0.000 0.090 phenotype 10/01/2014
79 233771 UTSW Rictor 1.000 R2145 G1 225 Y 15 6765107 R293C C T missense Het probably damaging 0.999 0.647 phenotype 10/01/2014
80 233699 UTSW Rif1 1.000 R2145 G1 225 Y 2 52111400 I1622N T A missense Het possibly damaging 0.625 0.179 phenotype 10/01/2014
81 233760 UTSW Rnf213 0.000 R2145 G1 225 Y 11 119415193 V609A T C missense Het probably benign 0.029 0.090 phenotype 10/01/2014
82 233726 UTSW Scgb1b2 0.053 R2145 G1 225 Y 7 31291763 G T intron Het probably benign 0.090 10/01/2014
83 233780 UTSW Serac1 0.000 R2145 G1 225 Y 17 6050785 I448N A T missense Het probably damaging 1.000 0.942 phenotype 10/01/2014
84 233790 UTSW Sh3kbp1 0.327 R2145 G1 222 Y X 159824496 T200K C A missense Het probably benign 0.090 0.086 phenotype 10/01/2014
85 233685 UTSW Sned1 0.072 R2145 G1 225 N 1 93271684 F495L T A missense Het probably damaging 0.996 10/01/2014
86 233758 UTSW Socs7 0.000 R2145 G1 225 Y 11 97373124 F281L T C missense Het probably benign 0.147 0.113 phenotype 10/01/2014
87 233695 UTSW Spta1 0.904 R2145 G1 225 Y 1 174212614 L1214F C T missense Het probably benign 0.003 0.090 phenotype 10/01/2014
88 233713 UTSW Ssu72 0.958 R2145 G1 217 Y 4 155705443 E21G A G missense Het probably damaging 0.979 0.854 10/01/2014
89 233727 UTSW Syngr4 0.065 R2145 G1 225 Y 7 45887040 V186A A G missense Het probably benign 0.012 0.080 phenotype 10/01/2014
90 233730 UTSW Tarsl2 0.116 R2145 G1 225 Y 7 65655791 M254I G A missense Het possibly damaging 0.568 0.203 10/01/2014
91 233719 UTSW Tmem130 0.058 R2145 G1 225 Y 5 144743785 V270L C A missense Het probably benign 0.076 0.091 10/01/2014
92 233733 UTSW Trim66 0.191 R2145 G1 225 Y 7 109475113 I647N A T missense Het probably damaging 0.981 0.090 10/01/2014
93 233789 UTSW Tspyl2 0.000 R2145 G1 222 Y X 152338894 D572E A T missense Het probably benign 0.003 0.090 phenotype 10/01/2014
94 233757 UTSW Unc45b 1.000 R2145 G1 225 Y 11 82917754 R222H G A missense Het probably benign 0.300 0.090 phenotype 10/01/2014
95 314427 UTSW Uxs1 1.000 R2145 G1 21 Y 1 43827623 Y29C T C missense Het probably damaging 1.000 0.149 phenotype 05/06/2015
96 233710 UTSW Virma 1.000 R2145 G1 225 Y 4 11548726 T A splice site Het probably benign 10/01/2014
97 233765 UTSW Vmn1r202 0.110 R2145 G1 225 Y 13 22501783 G155S C T missense Het possibly damaging 0.793 0.179 10/01/2014
98 233723 UTSW Vmn2r24 0.062 R2145 G1 225 Y 6 123779013 F15I T A missense Het probably benign 0.000 0.090 10/01/2014
99 233696 UTSW Wdr64 0.067 R2145 G1 225 Y 1 175767095 T471A A G missense Het probably benign 0.012 0.090 10/01/2014
100 233749 UTSW Zfa-ps 0.314 R2145 G1 225 Y 10 52543277 T A exon Het noncoding transcript 10/01/2014
[records 1 to 100 of 105] next >> last >|