Incidental Mutations

105 incidental mutations are currently displayed, and affect 105 genes.
17 are Possibly Damaging.
36 are Probably Damaging.
45 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 105] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 233743 UTSW 1110032A03Rik 0.000 R2145 G1 225 Y 9 50764874 Y32C T C missense Het probably damaging 0.998 0.647 10/01/2014
2 233734 UTSW Abca15 0.072 R2145 G1 225 Y 7 120354478 N535S A G missense Het probably benign 0.078 0.063 10/01/2014
3 233728 UTSW Abcc6 0.703 R2145 G1 225 Y 7 45998741 L717Q A T missense Het probably benign 0.012 0.090 phenotype 10/01/2014
4 233735 UTSW Abraxas2 0.000 R2145 G1 225 Y 7 132883061 Q278K C A missense Het probably benign 0.270 0.099 10/01/2014
5 233777 UTSW Acap2 0.138 R2145 G1 225 Y 16 31105524 D637E A T missense Het probably benign 0.000 0.090 10/01/2014
6 233783 UTSW AI661453 0.065 R2145 G1 225 Y 17 47466098 A G intron Het probably benign 0.090 10/01/2014
7 233764 UTSW Aoah 0.000 R2145 G1 225 Y 13 20840096 E74V A T missense Het probably damaging 0.999 0.146 phenotype 10/01/2014
8 233769 UTSW Appl1 0.330 R2145 G1 225 Y 14 26949619 L292S A G missense Het possibly damaging 0.659 0.413 phenotype 10/01/2014
9 233705 UTSW Astl 0.105 R2145 G1 225 Y 2 127347189 V166E T A missense Het probably damaging 1.000 0.647 phenotype 10/01/2014
10 233763 UTSW Atp5s 0.000 R2145 G1 225 Y 12 69741054 Q88R A G missense Het probably damaging 0.972 0.243 phenotype 10/01/2014
11 233786 UTSW Bbs1 0.753 R2145 G1 225 Y 19 4903707 K143Q T G missense Het possibly damaging 0.715 0.079 phenotype 10/01/2014
12 233779 UTSW Bbx 0.000 R2145 G1 225 Y 16 50274544 T C splice site Het probably benign phenotype 10/01/2014
13 233784 UTSW Birc6 1.000 R2145 G1 225 Y 17 74660413 Q4103L A T missense Het possibly damaging 0.712 0.076 phenotype 10/01/2014
14 233750 UTSW C1qtnf2 0.000 R2145 G1 225 Y 11 43490984 F178V T G missense Het probably damaging 1.000 0.321 10/01/2014
15 233754 UTSW Camta2 0.606 R2145 G1 225 Y 11 70671575 F999L A G missense Het probably benign 0.313 0.165 phenotype 10/01/2014
16 233781 UTSW Clcn7 1.000 R2145 G1 225 Y 17 25144451 I34V A G missense Het probably benign 0.000 0.090 phenotype 10/01/2014
17 233740 UTSW Cntn5 0.000 R2145 G1 225 Y 9 9748415 P487Q G T missense Het probably damaging 0.979 0.156 phenotype 10/01/2014
18 233739 UTSW Ctu2 1.000 R2145 G1 225 Y 8 122479152 I213K T A missense Het probably benign 0.164 0.090 phenotype 10/01/2014
19 233684 UTSW Des 0.595 R2145 G1 225 Y 1 75363464 C A splice site Het probably benign phenotype 10/01/2014
20 233776 UTSW Dgcr8 1.000 R2145 G1 225 Y 16 18280230 D432E A T missense Het probably benign 0.257 0.081 phenotype 10/01/2014
21 233770 UTSW Dlgap5 0.830 R2145 G1 225 Y 14 47395923 R549* G A nonsense Het probably null 0.976 phenotype 10/01/2014
22 233744 UTSW Dmxl2 1.000 R2145 G1 225 Y 9 54415910 T1397A T C missense Het probably damaging 0.999 0.226 phenotype 10/01/2014
23 233741 UTSW Dnmt1 1.000 R2145 G1 225 Y 9 20937155 T A splice site Het probably benign phenotype 10/01/2014
24 233721 UTSW Doxl2 0.000 R2145 G1 225 Y 6 48976695 D518V A T missense Het probably damaging 1.000 0.647 10/01/2014
25 233689 UTSW Dstyk 0.176 R2145 G1 225 Y 1 132463375 M838K T A missense Het probably damaging 1.000 0.515 phenotype 10/01/2014
26 233704 UTSW Dtwd1 0.000 R2145 G1 225 Y 2 126159984 T208N C A missense Het probably damaging 1.000 0.879 10/01/2014
27 233714 UTSW Dvl1 0.000 R2145 G1 122 Y 4 155847816 V28I G A missense Het possibly damaging 0.837 0.075 phenotype 10/01/2014
28 233700 UTSW Dync1i2 0.962 R2145 G1 225 Y 2 71214563 T A splice site Het probably benign phenotype 10/01/2014
29 233773 UTSW Fer1l6 0.093 R2145 G1 225 Y 15 58627534 M1251K T A missense Het probably benign 0.000 0.090 10/01/2014
30 233690 UTSW Fmod 0.322 R2145 G1 225 Y 1 134040518 Y99H T C missense Het probably benign 0.177 0.073 phenotype 10/01/2014
31 233683 UTSW Fn1 1.000 R2145 G1 225 Y 1 71606004 V1552D A T missense Het probably damaging 1.000 0.855 phenotype 10/01/2014
32 233709 UTSW Fnip2 0.000 R2145 G1 225 Y 3 79500432 S281T A T missense Het probably damaging 0.993 0.096 phenotype 10/01/2014
33 233748 UTSW Glb1 0.000 R2145 G1 225 Y 9 114464165 H536R A G missense Het probably benign 0.001 0.061 phenotype 10/01/2014
34 233774 UTSW Glis2 0.908 R2145 G1 225 Y 16 4613642 S344R T A missense Het possibly damaging 0.789 0.179 phenotype 10/01/2014
35 233732 UTSW Gm1966 0.109 R2145 G1 225 Y 7 106603008 H343L T A missense Het possibly damaging 0.844 0.179 10/01/2014
36 233694 UTSW Gm4847 0.135 R2145 G1 225 Y 1 166634903 S339R A T missense Het probably benign 0.004 0.090 10/01/2014
37 233701 UTSW Gpr155 0.000 R2145 G1 225 Y 2 73356658 S44P A G missense Het probably benign 0.006 0.065 10/01/2014
38 233766 UTSW Gprin1 0.000 R2145 G1 225 Y 13 54738632 P610S G A missense Het probably damaging 0.992 0.085 10/01/2014
39 233782 UTSW H2-Ob 0.075 R2145 G1 225 Y 17 34242580 M98L A T missense Het probably benign 0.003 0.138 phenotype 10/01/2014
40 314428 UTSW Hist1h3e 0.173 R2145 G1 41 Y 13 23562356 T4A T C missense Het probably benign 0.000 0.095 phenotype 05/06/2015
41 233697 UTSW Hmcn2 0.000 R2145 G1 225 Y 2 31333931 T C splice site Het probably benign 0.090 10/01/2014
42 233688 UTSW Ikbke 0.000 R2145 G1 225 Y 1 131273474 V176L C A missense Het probably damaging 0.978 0.265 phenotype 10/01/2014
43 233751 UTSW Il13 0.000 R2145 G1 225 Y 11 53632524 T85A T C missense Het possibly damaging 0.824 0.205 phenotype 10/01/2014
44 233756 UTSW Inpp5k 1.000 R2145 G1 225 Y 11 75647191 A T critical splice acceptor site Het probably null 0.949 phenotype 10/01/2014
45 233752 UTSW Irgm2 0.000 R2145 G1 225 Y 11 58220529 S361P T C missense Het possibly damaging 0.900 0.179 phenotype 10/01/2014
46 233745 UTSW Itga11 0.152 R2145 G1 163 Y 9 62732204 C T splice site Het probably benign phenotype 10/01/2014
47 233778 UTSW Kalrn 0.905 R2145 G1 225 Y 16 34009262 G T unclassified Het probably benign phenotype 10/01/2014
48 233707 UTSW Kcng1 0.131 R2145 G1 225 Y 2 168269032 G71C C A missense Het probably damaging 1.000 0.971 phenotype 10/01/2014
49 233681 UTSW Kcnq5 0.503 R2145 G1 225 Y 1 21505349 D291V T A missense Het probably damaging 0.957 0.756 phenotype 10/01/2014
50 233715 UTSW Klhl7 0.209 R2145 G1 174 N 5 24100863 M37L A T missense Het probably benign 0.000 phenotype 10/01/2014
51 233716 UTSW Letm1 0.960 R2145 G1 217 Y 5 33769515 A AG frame shift Het probably null 0.976 phenotype 10/01/2014
52 233698 UTSW Lhx6 0.815 R2145 G1 225 Y 2 36087466 V325I C T missense Het probably benign 0.007 0.107 phenotype 10/01/2014
53 233747 UTSW Lipc 0.090 R2145 G1 225 Y 9 70934535 I9T A G missense Het possibly damaging 0.942 0.195 phenotype 10/01/2014
54 233761 UTSW Lsmem1 0.075 R2145 G1 155 Y 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 10/01/2014
55 233736 UTSW Mast1 0.000 R2145 G1 225 Y 8 84921478 G458V C A missense Het probably damaging 1.000 0.954 10/01/2014
56 233702 UTSW Mga 0.945 R2145 G1 225 Y 2 119964157 V2565A T C missense Het possibly damaging 0.845 0.107 phenotype 10/01/2014
57 233775 UTSW Mkl2 1.000 R2145 G1 225 Y 16 13412586 I1045T T C missense Het probably damaging 0.981 0.128 phenotype 10/01/2014
58 233742 UTSW Mpzl2 0.000 R2145 G1 225 Y 9 45044173 D127E C G missense Het probably benign 0.013 0.090 phenotype 10/01/2014
59 233753 UTSW Myh3 0.420 R2145 G1 225 Y 11 67091056 C793S T A missense Het probably benign 0.000 0.071 phenotype 10/01/2014
60 233729 UTSW Nomo1 0.681 R2145 G1 225 Y 7 46066504 L765P T C missense Het probably damaging 1.000 0.751 10/01/2014
61 233722 UTSW Nup210 0.000 R2145 G1 225 N 6 91028876 I1335T A G missense Het possibly damaging 0.807 phenotype 10/01/2014
62 233731 UTSW Olfr549 0.077 R2145 G1 225 Y 7 102555060 T C unclassified 2862 bp Het probably null 0.976 phenotype 10/01/2014
63 233772 UTSW Oxr1 0.000 R2145 G1 225 Y 15 41819944 S254R T A missense Het probably damaging 1.000 0.107 phenotype 10/01/2014
64 233720 UTSW Pan3 0.311 R2145 G1 225 Y 5 147530098 I592V A G missense Het possibly damaging 0.872 0.197 10/01/2014
65 233686 UTSW Pask 0.108 R2145 G1 225 Y 1 93321297 A794T C T missense Het probably benign 0.004 0.079 phenotype 10/01/2014
66 233708 UTSW Pex2 1.000 R2145 G1 225 Y 3 5561590 E53G T C missense Het probably damaging 1.000 0.624 phenotype 10/01/2014
67 233687 UTSW Pfkfb2 0.000 R2145 G1 225 Y 1 130698723 T438A T C missense Het probably benign 0.005 0.090 phenotype 10/01/2014
68 233712 UTSW Phactr4 1.000 R2145 G1 225 Y 4 132370784 E391G T C missense Het probably damaging 0.976 0.064 phenotype 10/01/2014
69 233724 UTSW Pira2 0.074 R2145 G1 225 Y 7 3844345 L115Q A T missense Het probably damaging 1.000 0.303 10/01/2014
70 266063 UTSW Pkhd1l1 0.000 R2145 G1 225 N 15 44512877 A T synonymous Het probably null 02/05/2015
71 233787 UTSW Pnlip 0.165 R2145 G1 225 Y 19 58676444 S235G A G missense Het probably benign 0.110 0.206 phenotype 10/01/2014
72 233762 UTSW Prkd1 1.000 R2145 G1 225 Y 12 50489911 V130A A G missense Het possibly damaging 0.766 0.273 phenotype 10/01/2014
73 233717 UTSW Ptpn13 0.264 R2145 G1 225 Y 5 103556133 T1344A A G missense Het probably benign 0.000 0.059 phenotype 10/01/2014
74 233691 UTSW Ptprc 0.220 R2145 G1 225 Y 1 138073681 Y780C T C missense Het probably damaging 1.000 0.492 phenotype 10/01/2014
75 233718 UTSW Pxn 1.000 R2145 G1 225 Y 5 115552756 T A unclassified Het probably benign phenotype 10/01/2014
76 233755 UTSW Rap1gap2 0.421 R2145 G1 225 Y 11 74425976 T245M G A missense Het probably damaging 0.999 0.095 phenotype 10/01/2014
77 233692 UTSW Rc3h1 0.365 R2145 G1 225 Y 1 160930257 K48N G T missense Het probably damaging 0.998 0.151 phenotype 10/01/2014
78 233738 UTSW Rfwd3 0.671 R2145 G1 225 Y 8 111282613 I444V T C missense Het probably benign 0.000 0.090 phenotype 10/01/2014
79 233771 UTSW Rictor 1.000 R2145 G1 225 Y 15 6765107 R293C C T missense Het probably damaging 0.999 0.647 phenotype 10/01/2014
80 233699 UTSW Rif1 1.000 R2145 G1 225 Y 2 52111400 I1622N T A missense Het possibly damaging 0.625 0.179 phenotype 10/01/2014
81 233760 UTSW Rnf213 0.000 R2145 G1 225 Y 11 119415193 V609A T C missense Het probably benign 0.029 0.090 phenotype 10/01/2014
82 233726 UTSW Scgb1b2 0.059 R2145 G1 225 Y 7 31291763 G T intron Het probably benign 0.090 10/01/2014
83 233780 UTSW Serac1 0.000 R2145 G1 225 Y 17 6050785 I448N A T missense Het probably damaging 1.000 0.942 phenotype 10/01/2014
84 233790 UTSW Sh3kbp1 0.312 R2145 G1 222 Y X 159824496 T200K C A missense Het probably benign 0.090 0.086 phenotype 10/01/2014
85 233685 UTSW Sned1 0.091 R2145 G1 225 N 1 93271684 F495L T A missense Het probably damaging 0.996 10/01/2014
86 233758 UTSW Socs7 0.000 R2145 G1 225 Y 11 97373124 F281L T C missense Het probably benign 0.147 0.113 phenotype 10/01/2014
87 233695 UTSW Spta1 0.533 R2145 G1 225 Y 1 174212614 L1214F C T missense Het probably benign 0.003 0.090 phenotype 10/01/2014
88 233713 UTSW Ssu72 0.960 R2145 G1 217 Y 4 155705443 E21G A G missense Het probably damaging 0.979 0.854 10/01/2014
89 233727 UTSW Syngr4 0.075 R2145 G1 225 Y 7 45887040 V186A A G missense Het probably benign 0.012 0.080 phenotype 10/01/2014
90 233730 UTSW Tarsl2 0.146 R2145 G1 225 Y 7 65655791 M254I G A missense Het possibly damaging 0.568 0.203 10/01/2014
91 233719 UTSW Tmem130 0.055 R2145 G1 225 Y 5 144743785 V270L C A missense Het probably benign 0.076 0.091 10/01/2014
92 233733 UTSW Trim66 0.161 R2145 G1 225 Y 7 109475113 I647N A T missense Het probably damaging 0.981 0.090 10/01/2014
93 233789 UTSW Tspyl2 0.000 R2145 G1 222 Y X 152338894 D572E A T missense Het probably benign 0.003 0.090 phenotype 10/01/2014
94 233757 UTSW Unc45b 1.000 R2145 G1 225 Y 11 82917754 R222H G A missense Het probably benign 0.300 0.090 phenotype 10/01/2014
95 314427 UTSW Uxs1 1.000 R2145 G1 21 Y 1 43827623 Y29C T C missense Het probably damaging 1.000 0.149 phenotype 05/06/2015
96 233710 UTSW Virma 1.000 R2145 G1 225 Y 4 11548726 T A splice site Het probably benign 10/01/2014
97 233765 UTSW Vmn1r202 0.085 R2145 G1 225 Y 13 22501783 G155S C T missense Het possibly damaging 0.793 0.179 10/01/2014
98 233723 UTSW Vmn2r24 0.055 R2145 G1 225 Y 6 123779013 F15I T A missense Het probably benign 0.000 0.090 10/01/2014
99 233696 UTSW Wdr64 0.060 R2145 G1 225 Y 1 175767095 T471A A G missense Het probably benign 0.012 0.090 10/01/2014
100 233749 UTSW Zfa-ps 0.115 R2145 G1 225 Y 10 52543277 T A exon Het noncoding transcript phenotype 10/01/2014
[records 1 to 100 of 105] next >> last >|