Incidental Mutations

64 incidental mutations are currently displayed, and affect 63 genes.
16 are Possibly Damaging.
25 are Probably Damaging.
12 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 64 of 64] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 235371 UTSW Abca6 0.000 R2164 G1 167 N 11 110210193 CTGTAGGAAATCTTCAATGT CTGT frame shift Het probably null phenotype 10/01/2014
2 235381 UTSW Adcy8 0.110 R2164 G1 150 N 15 64920934 G58S C T missense Het probably benign 0.000 phenotype 10/01/2014
3 235358 UTSW Adgra2 1.000 R2164 G1 225 N 8 27114204 L24* T A nonsense Het probably null phenotype 10/01/2014
4 235333 UTSW Ampd2 0.176 R2164 G1 225 N 3 108085369 C A intron Het probably benign phenotype 10/01/2014
5 235344 UTSW Ankrd26 0.000 R2164 G1 225 N 6 118525791 E806A T G missense Het probably damaging 0.995 phenotype 10/01/2014
6 235382 UTSW Apol9b 0.000 R2164 G1 186 N 15 77735439 D145G A G missense Het probably benign 0.000 10/01/2014
7 235332 UTSW Ash1l 1.000 R2164 G1 225 N 3 88985419 M1535K T A missense Het probably benign 0.091 phenotype 10/01/2014
8 235323 UTSW Atf6 0.172 R2164 G1 225 N 1 170794735 M439T A G missense Het probably damaging 0.997 phenotype 10/01/2014
9 235342 UTSW B3glct 0.189 R2164 G1 225 N 5 149754156 M417L A T missense Het probably damaging 0.976 phenotype 10/01/2014
10 235393 UTSW Cep192 0.000 R2164 G1 225 N 18 67820360 T483S A T missense Het probably damaging 0.994 10/01/2014
11 235365 UTSW Cep290 0.948 R2164 G1 225 N 10 100518795 E914K G A missense Het probably damaging 0.958 phenotype 10/01/2014
12 235356 UTSW Chst15 0.093 R2164 G1 225 N 7 132270385 A56T C T missense Het probably damaging 0.974 phenotype 10/01/2014
13 235335 UTSW Col27a1 1.000 R2164 G1 225 N 4 63225424 T450S A T missense Het probably benign 0.210 phenotype 10/01/2014
14 235375 UTSW Cpsf2 0.966 R2164 G1 225 N 12 101985335 N177S A G missense Het probably damaging 1.000 10/01/2014
15 235380 UTSW Csmd3 0.000 R2164 G1 217 N 15 47741236 CCTTTGCGCTT CCTT frame shift Het probably null 0.976 10/01/2014
16 235368 UTSW Ctc1 1.000 R2164 G1 225 N 11 69035615 A859V C T missense Het possibly damaging 0.922 phenotype 10/01/2014
17 235370 UTSW Dcakd 0.000 R2164 G1 220 N 11 102997357 Y134H A G missense Het possibly damaging 0.774 10/01/2014
18 235334 UTSW Dctn3 0.964 R2164 G1 225 N 4 41723065 Y22* G T nonsense Het probably null phenotype 10/01/2014
19 235360 UTSW Dync2h1 1.000 R2164 G1 225 N 9 7124797 D2025V T A missense Het probably damaging 1.000 phenotype 10/01/2014
20 235389 UTSW Dync2li1 1.000 R2164 G1 225 N 17 84636274 S92P T C missense Het probably damaging 0.998 phenotype 10/01/2014
21 235374 UTSW Eml5 0.315 R2164 G1 225 N 12 98887097 V81A A G missense Het probably damaging 0.993 10/01/2014
22 235383 UTSW Espl1 1.000 R2164 G1 142 N 15 102319588 R1625C C T missense Het probably damaging 1.000 phenotype 10/01/2014
23 235376 UTSW Fam181a 0.120 R2164 G1 225 N 12 103316526 V230A T C missense Het probably benign 0.000 10/01/2014
24 235341 UTSW Fam213b 0.000 R2164 G1 213 N 4 154898149 Y56S T G missense Het probably damaging 1.000 10/01/2014
25 235350 UTSW Fanci 0.631 R2164 G1 170 N 7 79395995 D28E T A missense Het probably benign 0.216 phenotype 10/01/2014
26 235328 UTSW Fmn1 0.297 R2164 G1 225 N 2 113365617 N554S A G missense Het unknown phenotype 10/01/2014
27 235331 UTSW Frem2 1.000 R2164 G1 225 N 3 53537330 Y2460C T C missense Het probably damaging 1.000 phenotype 10/01/2014
28 235373 UTSW Fscb 0.075 R2164 G1 225 N 12 64473793 P300S G A missense Het probably damaging 0.958 10/01/2014
29 235329 UTSW Gm28042 0.413 R2164 G1 225 N 2 120036748 D438G A G missense Het probably benign 0.007 phenotype 10/01/2014
30 235377 UTSW Map1b 1.000 R2164 G1 225 N 13 99429338 V2292M C T missense Het unknown phenotype 10/01/2014
31 235372 UTSW Nbas 1.000 R2164 G1 225 N 12 13330646 D635G A G missense Het possibly damaging 0.740 phenotype 10/01/2014
32 236708 UTSW Ncapg2 1.000 R2164 G1 225 N 12 116450475 A G splice site Het probably null phenotype 10/01/2014
33 235321 UTSW Nrp2 0.949 R2164 G1 225 N 1 62744355 E205V A T missense Het probably damaging 1.000 phenotype 10/01/2014
34 235392 UTSW Pcdhb3 0.056 R2164 G1 225 N 18 37302186 T402S A T missense Het possibly damaging 0.779 phenotype 10/01/2014
35 235345 UTSW Phc1 1.000 R2164 G1 225 N 6 122322337 N638D T C missense Het possibly damaging 0.820 phenotype 10/01/2014
36 235330 UTSW Plcb1 0.260 R2164 G1 225 N 2 135346330 N781S A G missense Het possibly damaging 0.873 phenotype 10/01/2014
37 235384 UTSW Prkdc 0.961 R2164 G1 225 N 16 15705207 D1164E T A missense Het probably damaging 0.996 phenotype 10/01/2014
38 235325 UTSW Proser2 0.059 R2164 G1 225 N 2 6100695 R353W T A missense Het possibly damaging 0.953 10/01/2014
39 235327 UTSW Ptges 0.000 R2164 G1 225 N 2 30892696 T115S T A missense Het probably benign 0.310 phenotype 10/01/2014
40 235364 UTSW Ptprk 0.000 R2164 G1 225 N 10 28560142 D833V A T missense Het probably damaging 0.999 phenotype 10/01/2014
41 235338 UTSW Pum1 0.870 R2164 G1 225 N 4 130728083 L173* T A nonsense Het probably null phenotype 10/01/2014
42 235339 UTSW Pum1 0.870 R2164 G1 225 N 4 130728084 L269F G T missense Het probably damaging 0.994 phenotype 10/01/2014
43 235348 UTSW Rasgrp4 0.000 R2164 G1 225 N 7 29139045 Y106C A G missense Het probably damaging 1.000 phenotype 10/01/2014
44 235354 UTSW Rbbp6 1.000 R2164 G1 225 N 7 122999474 T A unclassified Het probably benign phenotype 10/01/2014
45 235366 UTSW Rdh1 0.071 R2164 G1 147 N 10 127760172 T79A A G missense Het possibly damaging 0.887 phenotype 10/01/2014
46 266082 UTSW Relb 0.940 R2164 G1 225 N 7 19613761 A C splice site 4012 bp Het probably null phenotype 02/05/2015
47 235359 UTSW Rnf122 0.059 R2164 G1 197 N 8 31112164 W6* G A nonsense Het probably null phenotype 10/01/2014
48 235378 UTSW Rnf31 1.000 R2164 G1 225 N 14 55592537 E138G A G missense Het possibly damaging 0.905 phenotype 10/01/2014
49 235385 UTSW Scaf8 0.863 R2164 G1 225 N 17 3197210 R936Q G A missense Het probably damaging 1.000 10/01/2014
50 235387 UTSW Scube3 0.481 R2164 G1 212 N 17 28166134 V686D T A missense Het possibly damaging 0.637 phenotype 10/01/2014
51 235343 UTSW Snrnp27 1.000 R2164 G1 225 N 6 86676214 C141S A T missense Het probably benign 0.026 phenotype 10/01/2014
52 235369 UTSW Spns2 0.000 R2164 G1 225 N 11 72458671 V252M C T missense Het possibly damaging 0.821 phenotype 10/01/2014
53 235353 UTSW Tmem159 0.065 R2164 G1 225 N 7 120120239 E157G A G missense Het possibly damaging 0.615 10/01/2014
54 235324 UTSW Tomm40l 0.295 R2164 G1 225 N 1 171220134 S220N C T missense Het probably damaging 0.999 10/01/2014
55 235367 UTSW Trim17 0.000 R2164 G1 225 N 11 58971411 D423G A G missense Het probably damaging 1.000 phenotype 10/01/2014
56 235361 UTSW Trpc6 0.000 R2164 G1 217 N 9 8610465 A AT nonsense Het probably null phenotype 10/01/2014
57 235363 UTSW Uba5 1.000 R2164 G1 225 N 9 104060243 M89K A T missense Het probably damaging 0.998 phenotype 10/01/2014
58 235326 UTSW Vav2 0.314 R2164 G1 225 N 2 27273706 D628G T C missense Het probably damaging 0.958 phenotype 10/01/2014
59 235386 UTSW Vmn2r107 0.112 R2164 G1 225 N 17 20375642 L819P T C missense Het probably damaging 1.000 10/01/2014
60 235346 UTSW Vmn2r25 0.103 R2164 G1 225 N 6 123839559 D354E A T missense Het possibly damaging 0.956 10/01/2014
61 235362 UTSW Xrn1 0.933 R2164 G1 225 N 9 96006820 E984G A G missense Het possibly damaging 0.954 phenotype 10/01/2014
62 235340 UTSW Zbtb17 1.000 R2164 G1 197 N 4 141464246 V223A T C missense Het probably benign 0.000 phenotype 10/01/2014
63 235336 UTSW Zcchc11 0.000 R2164 G1 225 N 4 108503029 R481Q G A missense Het possibly damaging 0.729 phenotype 10/01/2014
64 235351 UTSW Zfp592 0.910 R2164 G1 225 N 7 81041438 S1122P T C missense Het possibly damaging 0.865 phenotype 10/01/2014
[records 1 to 64 of 64]