Incidental Mutations

61 incidental mutations are currently displayed, and affect 61 genes.
6 are Possibly Damaging.
20 are Probably Damaging.
24 are Probably Benign.
11 are Probably Null.
3 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 61 of 61] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 237106 UTSW 1110017D15Rik 0.000 R2180 G1 225 N 4 41507170 M209L T A missense Het probably benign 0.001 phenotype 10/02/2014
2 237156 UTSW Adamts5 0.196 R2180 G1 225 N 16 85887924 D377G T C missense Het probably damaging 1.000 phenotype 10/02/2014
3 237105 UTSW Adgrl4 0.000 R2180 G1 225 N 3 151500142 I164F A T missense Het probably damaging 0.963 0.647 phenotype 10/02/2014
4 237104 UTSW Anxa9 0.000 R2180 G1 225 N 3 95306424 T C critical splice acceptor site Het probably null phenotype 10/02/2014
5 237094 UTSW Aox4 0.000 R2180 G1 225 N 1 58213067 T34S A T missense Het probably benign 0.002 phenotype 10/02/2014
6 237155 UTSW Asic1 0.194 R2180 G1 225 N 15 99671965 V56F G T missense Het probably benign 0.000 phenotype 10/02/2014
7 237109 UTSW Atpaf1 0.780 R2180 G1 225 N 4 115788360 M1T T C start codon destroyed Het probably null 0.025 phenotype 10/02/2014
8 237157 UTSW Axin1 1.000 R2180 G1 225 N 17 26143335 T218A A G missense Het probably benign 0.000 phenotype 10/02/2014
9 237139 UTSW BC049762 0.066 R2180 G1 225 N 11 51254610 W50L C A missense Het probably damaging 0.958 10/02/2014
10 237150 UTSW Bdp1 1.000 R2180 G1 194 N 13 100061405 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC small insertion Het probably benign phenotype 10/02/2014
11 237163 UTSW Birc6 1.000 R2180 G1 225 N 17 74612151 I1988T T C missense Het probably benign 0.027 phenotype 10/02/2014
12 237147 UTSW Btbd7 0.463 R2180 G1 225 N 12 102785897 D869E A T missense Het probably damaging 0.998 10/02/2014
13 237115 UTSW Caln1 0.149 R2180 G1 179 N 5 130839408 *220Q T C makesense Het probably null phenotype 10/02/2014
14 237093 UTSW Ccdc150 0.059 R2180 G1 225 N 1 54272547 G A critical splice donor site 1 bp Het probably null 10/02/2014
15 237154 UTSW Ccnt1 0.944 R2180 G1 225 N 15 98543600 S596T A T missense Het possibly damaging 0.740 phenotype 10/02/2014
16 237100 UTSW Cd44 0.322 R2180 G1 225 N 2 102828610 G640E C T missense Het possibly damaging 0.664 phenotype 10/02/2014
17 237164 UTSW Cep192 0.000 R2180 G1 225 N 18 67824742 E582G A G missense Het possibly damaging 0.820 10/02/2014
18 237110 UTSW Clcnkb 0.000 R2180 G1 225 N 4 141409508 G T unclassified Het probably null phenotype 10/02/2014
19 237151 UTSW Dhx29 1.000 R2180 G1 225 N 13 112962872 T C critical splice donor site 2 bp Het probably null phenotype 10/02/2014
20 237158 UTSW Dnah8 0.375 R2180 G1 225 N 17 30840647 F4407S T C missense Het probably benign 0.002 phenotype 10/02/2014
21 237098 UTSW Enah 0.869 R2180 G1 225 N 1 181918459 M419K A T missense Het probably damaging 1.000 phenotype 10/02/2014
22 237096 UTSW Fam129a 0.000 R2180 G1 225 N 1 151718078 H838L A T missense Het probably benign 0.020 phenotype 10/02/2014
23 237118 UTSW Fancd2 1.000 R2180 G1 225 N 6 113574637 T1055S A T missense Het probably benign 0.329 phenotype 10/02/2014
24 237095 UTSW Gigyf2 0.928 R2180 G1 225 N 1 87416920 G525D G A missense Het probably damaging 1.000 phenotype 10/02/2014
25 237153 UTSW Gm5800 0.069 R2180 G1 225 N 14 51715994 K55* T A nonsense Het probably null 10/02/2014
26 237103 UTSW Gpr149 0.077 R2180 G1 225 N 3 62604068 L170P A G missense Het probably damaging 1.000 phenotype 10/02/2014
27 237131 UTSW Grik4 0.109 R2180 G1 225 N 9 42542005 Y695N A T missense Het probably benign 0.447 phenotype 10/02/2014
28 237120 UTSW Gsg1 0.063 R2180 G1 225 N 6 135240145 V228D A T missense Het probably damaging 1.000 10/02/2014
29 237137 UTSW Helb 0.211 R2180 G1 225 N 10 120105448 T445M G A missense Het probably benign 0.016 phenotype 10/02/2014
30 237102 UTSW Helz2 0.000 R2180 G1 225 N 2 181233732 D1656E A T missense Het probably damaging 1.000 phenotype 10/02/2014
31 237132 UTSW Hyou1 1.000 R2180 G1 225 N 9 44388019 K669M A T missense Het probably benign 0.296 phenotype 10/02/2014
32 237152 UTSW Itga2 0.000 R2180 G1 225 N 13 114849381 N953D T C missense Het possibly damaging 0.670 phenotype 10/02/2014
33 237129 UTSW Ldhd 0.158 R2180 G1 225 N 8 111629386 I122V T C missense Het probably benign 0.054 phenotype 10/02/2014
34 237117 UTSW Lrrtm1 0.000 R2180 G1 225 N 6 77244346 D262G A G missense Het probably damaging 1.000 phenotype 10/02/2014
35 237114 UTSW Mapkapk5 0.000 R2180 G1 225 N 5 121535864 T C intron 1248 bp Het probably null phenotype 10/02/2014
36 237124 UTSW Numa1 1.000 R2180 G1 225 N 7 101999990 I976T T C missense Het probably benign 0.001 phenotype 10/02/2014
37 237101 UTSW Olfr1307 0.094 R2180 G1 225 N 2 111945003 V151A A G missense Het probably benign 0.392 phenotype 10/02/2014
38 237097 UTSW Olfr417 0.062 R2180 G1 225 N 1 174369401 I161M A G missense Het probably damaging 0.986 phenotype 10/02/2014
39 237116 UTSW Olfr446 0.212 R2180 G1 225 N 6 42927525 T98I C T missense Het probably benign 0.135 phenotype 10/02/2014
40 237125 UTSW Olfr677 0.128 R2180 G1 225 N 7 105056885 I213T T C missense Het probably benign 0.179 phenotype 10/02/2014
41 237108 UTSW Patj 0.000 R2180 G1 225 N 4 98523502 G A critical splice donor site 1 bp Het probably null phenotype 10/02/2014
42 237141 UTSW Pfas 1.000 R2180 G1 225 N 11 68992187 D757G T C missense Het possibly damaging 0.922 phenotype 10/02/2014
43 237148 UTSW Pom121l2 0.071 R2180 G1 225 N 13 21981975 N139D A G missense Het probably benign 0.075 10/02/2014
44 237134 UTSW Ppp2r3a 0.000 R2180 G1 225 N 9 101127015 Y994* A T nonsense Het probably null phenotype 10/02/2014
45 237099 UTSW Ppp6c 1.000 R2180 G1 225 N 2 39197513 D227G T C missense Het probably benign 0.009 phenotype 10/02/2014
46 237113 UTSW Ptpn13 0.289 R2180 G1 225 N 5 103569558 H1855Q T G missense Het probably damaging 1.000 phenotype 10/02/2014
47 237121 UTSW Ptprh 0.000 R2180 G1 225 N 7 4601868 Q59L T A missense Het probably benign 0.258 phenotype 10/02/2014
48 237142 UTSW Rap1gap2 0.526 R2180 G1 220 N 11 74393146 K669E T C missense Het probably benign 0.240 phenotype 10/02/2014
49 237128 UTSW Rbl2 1.000 R2180 G1 225 N 8 91090055 S348P T C missense Het possibly damaging 0.507 phenotype 10/02/2014
50 237145 UTSW Rptor 1.000 R2180 G1 225 N 11 119725144 N161K T A missense Het probably damaging 1.000 phenotype 10/02/2014
51 237160 UTSW Satb1 1.000 R2180 G1 225 N 17 51803496 A192T C T missense Het probably damaging 0.962 phenotype 10/02/2014
52 237135 UTSW Scn5a 1.000 R2180 G1 220 N 9 119516051 V1083A A G missense Het probably benign 0.000 phenotype 10/02/2014
53 237138 UTSW Sec14l2 0.155 R2180 G1 225 N 11 4108964 A194T C T missense Het probably damaging 1.000 phenotype 10/02/2014
54 237123 UTSW Sema4b 0.848 R2180 G1 195 N 7 80212835 N53S A G missense Het probably benign 0.281 phenotype 10/02/2014
55 237127 UTSW Sin3b 1.000 R2180 G1 225 N 8 72753295 Y876* T A nonsense Het probably null phenotype 10/02/2014
56 237162 UTSW Smchd1 0.810 R2180 G1 225 N 17 71463799 M129I C A missense Het probably benign 0.231 phenotype 10/02/2014
57 237165 UTSW Tmc1 0.078 R2180 G1 225 N 19 20824084 Y484C T C missense Het probably damaging 0.957 phenotype 10/02/2014
58 237136 UTSW Utp20 0.944 R2180 G1 225 N 10 88820939 S135P A G missense Het probably damaging 0.983 phenotype 10/02/2014
59 237130 UTSW Zfp266 0.063 R2180 G1 225 N 9 20499679 C401S A T missense Het probably damaging 1.000 phenotype 10/02/2014
60 237149 UTSW Zfp738 0.093 R2180 G1 225 N 13 67671194 T226I G A missense Het probably damaging 1.000 10/02/2014
61 237159 UTSW Zfp871 1.000 R2180 G1 225 N 17 32775301 T300M G A missense Het probably damaging 1.000 10/02/2014
[records 1 to 61 of 61]