Incidental Mutations

52 incidental mutations are currently displayed, and affect 52 genes.
10 are Possibly Damaging.
24 are Probably Damaging.
12 are Probably Benign.
6 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 52 of 52] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 237858 UTSW 2310050C09Rik 0.078 R2187 G1 225 N 3 92868615 S254P A G missense Het probably damaging 0.999 10/02/2014
2 237901 UTSW Abcg1 0.493 R2187 G1 206 N 17 31105517 S245R T A missense Het probably damaging 0.991 phenotype 10/02/2014
3 237849 UTSW AI597479 0.125 R2187 G1 225 N 1 43100823 W70R T A missense Het probably damaging 1.000 10/02/2014
4 237896 UTSW Ankrd55 0.000 R2187 G1 225 N 13 112383505 S575G A G missense Het probably benign 0.015 10/02/2014
5 237877 UTSW Bfsp2 0.234 R2187 G1 214 N 9 103426777 K343* T A nonsense Het probably null phenotype 10/02/2014
6 237885 UTSW Cant1 0.148 R2187 G1 225 N 11 118408841 Y227* A T nonsense Het probably null phenotype 10/02/2014
7 237871 UTSW Cd2bp2 0.943 R2187 G1 225 N 7 127194791 N109D T C missense Het probably benign 0.058 phenotype 10/02/2014
8 237886 UTSW Chmp6 1.000 R2187 G1 225 N 11 119916736 E135G A G missense Het possibly damaging 0.952 phenotype 10/02/2014
9 237892 UTSW Dsp 1.000 R2187 G1 225 N 13 38176407 S329R T G missense Het probably damaging 0.999 phenotype 10/02/2014
10 237864 UTSW Epha5 0.000 R2187 G1 225 N 5 84086364 F767L A T missense Het probably damaging 1.000 phenotype 10/02/2014
11 237860 UTSW Epha7 0.594 R2187 G1 225 N 4 28942648 T566S A T missense Het possibly damaging 0.626 phenotype 10/02/2014
12 237895 UTSW Erap1 0.158 R2187 G1 225 N 13 74662405 I288F A T missense Het probably damaging 0.977 phenotype 10/02/2014
13 237857 UTSW Erich6 0.060 R2187 G1 225 N 3 58629845 A G critical splice donor site 2 bp Het probably null 10/02/2014
14 237861 UTSW Fbxo10 0.000 R2187 G1 217 N 4 45058531 V402A A G missense Het probably benign 0.090 phenotype 10/02/2014
15 237900 UTSW Fndc1 0.072 R2187 G1 225 N 17 7741772 I1604F T A missense Het probably damaging 0.999 10/02/2014
16 237907 UTSW Foxd4 0.000 R2187 G1 225 N 19 24899855 Q327P T G missense Het probably damaging 0.984 phenotype 10/02/2014
17 237906 UTSW Fxn 1.000 R2187 G1 117 N 19 24280489 N26I T A missense Het probably benign 0.341 phenotype 10/02/2014
18 237884 UTSW Hsf5 0.222 R2187 G1 225 N 11 87638184 G582C G T missense Het possibly damaging 0.510 10/02/2014
19 237853 UTSW Itga8 0.719 R2187 G1 225 N 2 12194420 V522A A G missense Het possibly damaging 0.596 phenotype 10/02/2014
20 237889 UTSW Lyst 0.351 R2187 G1 225 N 13 13709341 T2938I C T missense Het possibly damaging 0.613 phenotype 10/02/2014
21 237863 UTSW Mib2 0.000 R2187 G1 225 N 4 155654933 E863G T C missense Het possibly damaging 0.955 phenotype 10/02/2014
22 237868 UTSW Mrgpra9 0.058 R2187 G1 225 N 7 47235049 F290S A G missense Het probably damaging 1.000 10/02/2014
23 237879 UTSW Mst1 0.000 R2187 G1 225 N 9 108084340 Y599H T C missense Het possibly damaging 0.630 phenotype 10/02/2014
24 237891 UTSW Mylk4 0.000 R2187 G1 225 N 13 32722013 I165V T C missense Het probably damaging 0.966 10/02/2014
25 237865 UTSW Nipsnap2 0.000 R2187 G1 225 N 5 129746473 T C splice site 6 bp Het probably null phenotype 10/02/2014
26 237893 UTSW Nol8 1.000 R2187 G1 225 N 13 49661999 Y528H T C missense Het probably benign 0.001 phenotype 10/02/2014
27 237873 UTSW Nup93 0.940 R2187 G1 225 N 8 94300850 S295R T A missense Het probably damaging 1.000 phenotype 10/02/2014
28 237894 UTSW Nutm2 0.000 R2187 G1 225 N 13 50467417 Q6L A T missense Het probably benign 0.002 10/02/2014
29 237890 UTSW Olfr11 0.178 R2187 G1 225 N 13 21639385 I46N A T missense Het probably damaging 0.986 phenotype 10/02/2014
30 237905 UTSW Olfr1445 0.092 R2187 G1 225 N 19 12884255 C125S T A missense Het probably damaging 1.000 phenotype 10/02/2014
31 237883 UTSW Olfr820 0.069 R2187 G1 225 N 10 130017688 E109G A G missense Het probably damaging 1.000 phenotype 10/02/2014
32 237854 UTSW Olfr988 0.071 R2187 G1 225 N 2 85353915 S4R T G missense Het probably benign 0.000 phenotype 10/02/2014
33 237859 UTSW Pip5k1a 0.000 R2187 G1 225 N 3 95071918 L189Q A T missense Het probably damaging 1.000 phenotype 10/02/2014
34 237867 UTSW Plekha4 0.154 R2187 G1 225 N 7 45549274 R574C C T missense Het probably damaging 0.993 10/02/2014
35 237872 UTSW Ppp2cb 0.000 R2187 G1 225 N 8 33610677 E42G A G missense Het possibly damaging 0.952 phenotype 10/02/2014
36 237902 UTSW Prkd3 0.124 R2187 G1 225 N 17 78975554 Q244L T A missense Het probably benign 0.000 phenotype 10/02/2014
37 237852 UTSW Ptpn14 0.000 R2187 G1 225 N 1 189863228 R1023* C T nonsense Het probably null phenotype 10/02/2014
38 237855 UTSW Ptpra 0.000 R2187 G1 225 N 2 130504299 T127A A G missense Het probably benign 0.000 phenotype 10/02/2014
39 237878 UTSW Rad54l2 1.000 R2187 G1 105 N 9 106753992 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC small deletion Het probably benign phenotype 10/02/2014
40 237876 UTSW Rasgrf1 0.000 R2187 G1 225 N 9 89994835 I751T T C missense Het possibly damaging 0.928 phenotype 10/02/2014
41 237904 UTSW Rbm27 0.000 R2187 G1 225 N 18 42325957 K697R A G missense Het probably damaging 1.000 10/02/2014
42 237880 UTSW Rhoa R2187 G1 225 N 9 108335153 T127M C T missense Het probably benign 0.391 phenotype 10/02/2014
43 237850 UTSW Rnpepl1 0.000 R2187 G1 225 N 1 92916895 S370G A G missense Het probably null 0.999 10/02/2014
44 237866 UTSW Sdk1 0.078 R2187 G1 225 N 5 142114574 T1453I C T missense Het probably damaging 0.998 phenotype 10/02/2014
45 237856 UTSW Sel1l2 0.504 R2187 G1 225 N 2 140230873 L614S A G missense Het probably damaging 0.999 10/02/2014
46 237881 UTSW Slc6a20b 0.000 R2187 G1 225 N 9 123598588 I419F T A missense Het probably damaging 0.999 10/02/2014
47 237903 UTSW Slc8a1 1.000 R2187 G1 225 N 17 81648553 S352N C T missense Het possibly damaging 0.476 phenotype 10/02/2014
48 237851 UTSW Spta1 0.884 R2187 G1 225 N 1 174192966 D547G A G missense Het probably damaging 1.000 phenotype 10/02/2014
49 237888 UTSW Tc2n 0.076 R2187 G1 225 N 12 101706544 T46I G A missense Het probably damaging 0.998 10/02/2014
50 237874 UTSW Terb1 0.000 R2187 G1 225 N 8 104472884 Y476F T A missense Het probably benign 0.000 phenotype 10/02/2014
51 237869 UTSW Trim12a 0.058 R2187 G1 225 N 7 104304192 E237D T A missense Het probably damaging 0.979 10/02/2014
52 237870 UTSW Usp47 0.868 R2187 G1 225 N 7 112067191 L309P T C missense Het probably damaging 1.000 phenotype 10/02/2014
[records 1 to 52 of 52]