Incidental Mutations

46 incidental mutations are currently displayed, and affect 46 genes.
4 are Possibly Damaging.
18 are Probably Damaging.
16 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 46 of 46] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 241217 UTSW Adat1 0.102 R2217 G1 225 N 8 111982496 K232E T C missense Het probably benign 0.002 phenotype 10/15/2014
2 241240 UTSW Apba1 0.000 R2217 G1 225 N 19 23893962 M386T T C missense Het probably damaging 0.990 phenotype 10/15/2014
3 241220 UTSW Appl2 0.000 R2217 G1 225 N 10 83608737 F472L G T missense Het possibly damaging 0.472 phenotype 10/15/2014
4 241202 UTSW Atxn2 0.674 R2217 G1 225 N 5 121803077 Y56H T C missense Het probably damaging 1.000 phenotype 10/15/2014
5 241206 UTSW Cacna1c 0.350 R2217 G1 225 N 6 118670407 Y809C T C missense Het probably damaging 1.000 phenotype 10/15/2014
6 241224 UTSW Canx 0.512 R2217 G1 225 N 11 50310867 V59I C T missense Het probably benign 0.244 phenotype 10/15/2014
7 241230 UTSW Catsperb 0.064 R2217 G1 206 N 12 101594219 L823P T C missense Het probably damaging 0.991 10/15/2014
8 241236 UTSW Crb3 1.000 R2217 G1 225 N 17 57065090 S46P T C missense Het probably benign 0.249 phenotype 10/15/2014
9 241229 UTSW Daam1 1.000 R2217 G1 225 N 12 71989827 R1058H G A missense Het probably damaging 1.000 phenotype 10/15/2014
10 241238 UTSW Ehd1 1.000 R2217 G1 225 N 19 6298472 D493E T A missense Het probably damaging 0.999 phenotype 10/15/2014
11 241221 UTSW Eml6 0.269 R2217 G1 225 N 11 29818907 Q746L T A missense Het probably damaging 0.999 10/15/2014
12 241237 UTSW Epg5 0.939 R2217 G1 225 N 18 77949072 M328K T A missense Het probably benign 0.000 phenotype 10/15/2014
13 241223 UTSW Flt4 1.000 R2217 G1 225 N 11 49624728 S48T T A missense Het probably benign 0.002 phenotype 10/15/2014
14 241218 UTSW Gm10608 0.082 R2217 G1 163 N 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA frame shift Het probably null 10/15/2014
15 241233 UTSW Gm7535 0.323 R2217 G1 225 N 17 17911674 A G intron Het probably benign 10/15/2014
16 241213 UTSW Gpat4 0.474 R2217 G1 225 N 8 23180155 P286L G A missense Het probably damaging 0.968 0.942 phenotype 10/15/2014
17 241192 UTSW Hmcn2 0.000 R2217 G1 217 N 2 31350574 T494S A T missense Het probably benign 0.019 10/15/2014
18 241216 UTSW Hydin 0.674 R2217 G1 225 N 8 110418506 V830I G A missense Het probably benign 0.000 phenotype 10/15/2014
19 241201 UTSW Map3k6 0.340 R2217 G1 225 N 4 133246672 H487Q T A missense Het possibly damaging 0.456 phenotype 10/15/2014
20 241209 UTSW Myh14 0.000 R2217 G1 225 N 7 44634376 P735S G A missense Het probably damaging 1.000 phenotype 10/15/2014
21 241241 UTSW Nfkb2 0.727 R2217 G1 225 N 19 46307724 T C splice site 6 bp Het probably null phenotype 10/15/2014
22 241207 UTSW Nlrp4c 0.062 R2217 G1 225 N 7 6073114 V671A T C missense Het probably benign 0.000 10/15/2014
23 241227 UTSW Nsrp1 1.000 R2217 G1 225 N 11 77045761 Y536* A T nonsense Het probably null phenotype 10/15/2014
24 241193 UTSW Olfr1217 0.093 R2217 G1 225 N 2 89023426 H192Q G T missense Het probably benign 0.411 0.395 phenotype 10/15/2014
25 241197 UTSW Pak7 0.000 R2217 G1 225 N 2 136116203 S322P A G missense Het probably damaging 0.998 phenotype 10/15/2014
26 241196 UTSW Pank2 0.155 R2217 G1 225 N 2 131282681 A G intron 8418 bp Het probably null phenotype 10/15/2014
27 241242 UTSW Phf6 R2217 G1 222 N X 52942648 I272F A T missense Het probably damaging 0.991 phenotype 10/15/2014
28 241191 UTSW Plxna2 0.000 R2217 G1 191 N 1 194797748 L1409P T C missense Het probably damaging 1.000 phenotype 10/15/2014
29 241226 UTSW Polr2a 0.965 R2217 G1 225 N 11 69742685 A G critical splice donor site 2 bp Het probably null phenotype 10/15/2014
30 241235 UTSW Pp2d1 0.060 R2217 G1 225 N 17 53515454 V195L C A missense Het probably benign 0.021 10/15/2014
31 241210 UTSW Psma1 0.636 R2217 G1 225 N 7 114264938 E227K C T missense Het unknown phenotype 10/15/2014
32 241215 UTSW Ptger1 0.088 R2217 G1 174 N 8 83668728 T278I C T missense Het probably benign 0.026 phenotype 10/15/2014
33 241212 UTSW Slc20a2 0.132 R2217 G1 225 N 8 22560516 S250R C A missense Het probably benign 0.117 phenotype 10/15/2014
34 241194 UTSW Slc27a2 0.000 R2217 G1 225 N 2 126567752 T285A A G missense Het probably damaging 0.992 phenotype 10/15/2014
35 241225 UTSW Slc47a2 0.000 R2217 G1 225 N 11 61313671 T285A T C missense Het probably benign 0.001 10/15/2014
36 241231 UTSW Slf1 0.000 R2217 G1 225 N 13 77046706 T A critical splice acceptor site Het probably null phenotype 10/15/2014
37 241232 UTSW Tiam2 0.000 R2217 G1 225 N 17 3415114 T373A A G missense Het probably benign 0.340 phenotype 10/15/2014
38 241222 UTSW Timd2 0.078 R2217 G1 225 N 11 46687017 I96L T A missense Het probably damaging 0.999 phenotype 10/15/2014
39 241214 UTSW Tmem59l 0.081 R2217 G1 103 N 8 70487301 L6S A G missense Het unknown 0.087 phenotype 10/15/2014
40 241199 UTSW Tmem64 0.131 R2217 G1 225 N 4 15266658 I236T T C missense Het possibly damaging 0.893 phenotype 10/15/2014
41 241219 UTSW Trpm2 0.147 R2217 G1 225 N 10 77941182 D427V T A missense Het probably damaging 1.000 phenotype 10/15/2014
42 241205 UTSW Vax2 0.768 R2217 G1 225 N 6 83737889 Y262F A T missense Het probably damaging 0.982 phenotype 10/15/2014
43 241198 UTSW Virma 1.000 R2217 G1 225 N 4 11544924 S1628P T C missense Het probably damaging 0.999 10/15/2014
44 241204 UTSW Zan 0.073 R2217 G1 225 N 5 137410306 C A utr 3 prime Het probably benign phenotype 10/15/2014
45 241234 UTSW Zbtb22 0.175 R2217 G1 225 N 17 33917965 D361E T G missense Het probably damaging 0.995 10/15/2014
46 241208 UTSW Zfp27 0.624 R2217 G1 225 N 7 29896111 L143P A G missense Het possibly damaging 0.956 10/15/2014
[records 1 to 46 of 46]