Incidental Mutations

75 incidental mutations are currently displayed, and affect 75 genes.
10 are Possibly Damaging.
27 are Probably Damaging.
30 are Probably Benign.
7 are Probably Null.
1 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 75 of 75] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 239607 UTSW Adam24 0.101 R2229 G1 225 Y 8 40680365 I291L A T missense Het probably benign 0.001 0.090 phenotype 10/15/2014
2 239628 UTSW Adcy8 0.117 R2229 G1 225 Y 15 64822207 R407L C A missense Het possibly damaging 0.580 0.715 phenotype 10/15/2014
3 239613 UTSW Adgb 0.000 R2229 G1 225 Y 10 10436051 V212E A T missense Het probably damaging 0.999 0.647 10/15/2014
4 239633 UTSW Adgrg7 0.000 R2229 G1 225 Y 16 56752403 S350N C T missense Het probably benign 0.000 0.090 phenotype 10/15/2014
5 239599 UTSW Agbl1 0.000 R2229 G1 225 Y 7 76433378 T448A A G missense Het probably benign 0.425 0.090 phenotype 10/15/2014
6 239595 UTSW Aldh1l1 0.000 R2229 G1 225 Y 6 90583186 T605R C G missense Het probably damaging 0.999 0.912 phenotype 10/15/2014
7 239581 UTSW Arfip1 0.491 R2229 G1 225 Y 3 84547973 N18K A T missense Het probably damaging 1.000 0.136 10/15/2014
8 239608 UTSW Atp6v1b2 1.000 R2229 G1 225 Y 8 69102759 C A splice site Het probably null 0.976 phenotype 10/15/2014
9 239610 UTSW Banp 0.916 R2229 G1 225 Y 8 121978685 S98N G A missense Het probably damaging 0.993 0.061 phenotype 10/15/2014
10 239618 UTSW Btnl9 0.050 R2229 G1 225 Y 11 49169118 D601G T C missense Het probably damaging 1.000 0.347 10/15/2014
11 239627 UTSW C9 0.000 R2229 G1 225 Y 15 6445420 I20T T C missense Het possibly damaging 0.951 0.179 phenotype 10/15/2014
12 239570 UTSW Cacna1b 0.000 R2229 G1 225 Y 2 24685804 V744A A G missense Het probably damaging 1.000 0.064 phenotype 10/15/2014
13 239623 UTSW Catsper3 0.000 R2229 G1 225 Y 13 55808054 E311G A G missense Het probably damaging 1.000 0.086 phenotype 10/15/2014
14 239587 UTSW Ccdc180 0.000 R2229 G1 225 Y 4 45948856 G T critical splice donor site 1 bp Het probably null 0.949 phenotype 10/15/2014
15 239635 UTSW Cdc5l 0.966 R2229 G1 225 N 17 45407846 Y615H A G missense Het probably benign 0.040 phenotype 10/15/2014
16 239589 UTSW Crybg2 0.826 R2229 G1 114 Y 4 134074526 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG small deletion Het probably benign 10/15/2014
17 239637 UTSW Eml4 0.875 R2229 G1 225 Y 17 83451056 P502S C T missense Het probably benign 0.050 0.062 phenotype 10/15/2014
18 239576 UTSW Fsip1 0.051 R2229 G1 225 Y 2 118222444 E367G T C missense Het probably benign 0.004 0.090 10/15/2014
19 239626 UTSW Gja3 0.076 R2229 G1 225 Y 14 57036714 D67G T C missense Het probably damaging 1.000 0.944 phenotype 10/15/2014
20 239612 UTSW Gm4894 0.062 R2229 G1 225 Y 9 49274190 T C splice site Het probably benign 10/15/2014
21 239625 UTSW Gm7853 0.078 R2229 G1 225 Y 14 36089527 A G exon Het noncoding transcript 10/15/2014
22 239580 UTSW Gmps 0.955 R2229 G1 225 Y 3 64014263 Y562* T G nonsense Het probably null 0.976 phenotype 10/15/2014
23 239571 UTSW Golga2 0.840 R2229 G1 225 Y 2 32306465 P976T C A missense Het probably benign 0.063 0.090 phenotype 10/15/2014
24 239616 UTSW Gpr182 0.000 R2229 G1 225 Y 10 127750141 I314F T A missense Het possibly damaging 0.913 0.252 phenotype 10/15/2014
25 239614 UTSW Gprc6a 0.000 R2229 G1 225 Y 10 51626795 V324A A G missense Het possibly damaging 0.503 0.664 phenotype 10/15/2014
26 239639 UTSW Gykl1 0.341 R2229 G1 225 Y 18 52695267 T516A A G missense Het probably benign 0.001 0.090 phenotype 10/15/2014
27 239582 UTSW Hist2h2ab 0.381 R2229 G1 225 Y 3 96220106 L64P T C missense Het possibly damaging 0.837 0.904 phenotype 10/15/2014
28 239643 UTSW Ifit1bl2 0.000 R2229 G1 225 Y 19 34619230 L329M G T missense Het possibly damaging 0.700 0.179 10/15/2014
29 239611 UTSW Igsf9b 0.528 R2229 G1 225 Y 9 27333496 S920P T C missense Het probably damaging 0.998 0.094 10/15/2014
30 239622 UTSW Kif3c 0.198 R2229 G1 225 Y 12 3366671 S231T T A missense Het probably benign 0.012 0.060 phenotype 10/15/2014
31 239593 UTSW Kpna7 0.382 R2229 G1 225 Y 5 144989697 Y482N A T missense Het probably damaging 0.992 0.647 phenotype 10/15/2014
32 239615 UTSW Lmnb2 1.000 R2229 G1 225 Y 10 80904392 T C unclassified Het probably benign 0.090 phenotype 10/15/2014
33 239583 UTSW Lrrc69 0.079 R2229 G1 225 Y 4 14773694 S121G T C missense Het probably benign 0.002 0.090 10/15/2014
34 239641 UTSW Mppe1 0.111 R2229 G1 225 Y 18 67228011 A G critical splice donor site 2 bp Het probably null 0.959 10/15/2014
35 239603 UTSW Muc5b 0.168 R2229 G1 225 Y 7 141861644 C2776S T A missense Het possibly damaging 0.711 0.178 phenotype 10/15/2014
36 239619 UTSW Myh8 0.872 R2229 G1 225 Y 11 67308348 N1893K T G missense Het probably damaging 0.979 0.162 phenotype 10/15/2014
37 239601 UTSW Myo7a 0.000 R2229 G1 225 Y 7 98054910 T1932A T C missense Het probably benign 0.119 0.106 phenotype 10/15/2014
38 239584 UTSW Nbn 1.000 R2229 G1 225 Y 4 15970904 T296A A G missense Het probably benign 0.011 0.090 phenotype 10/15/2014
39 239632 UTSW Nckap1l 0.868 R2229 G1 225 Y 15 103455934 T C critical splice donor site 2 bp Het probably null 0.950 phenotype 10/15/2014
40 239605 UTSW Nek5 0.066 R2229 G1 225 Y 8 22113632 N151K A T missense Het possibly damaging 0.762 0.260 phenotype 10/15/2014
41 239609 UTSW Nup93 0.925 R2229 G1 225 Y 8 94304191 T305I C T missense Het probably benign 0.269 0.098 phenotype 10/15/2014
42 239598 UTSW Oca2 0.258 R2229 G1 225 Y 7 56357155 H663Q T A missense Het probably benign 0.106 0.070 phenotype 10/15/2014
43 239569 UTSW Optn 0.141 R2229 G1 225 Y 2 5024117 H525L T A missense Het probably damaging 1.000 0.618 phenotype 10/15/2014
44 239636 UTSW Pdzph1 0.105 R2229 G1 225 Y 17 58932412 A G splice site Het probably benign 10/15/2014
45 239567 UTSW Pikfyve 1.000 R2229 G1 225 Y 1 65267855 K1801E A G missense Het probably damaging 0.999 0.261 phenotype 10/15/2014
46 239638 UTSW Pkd2l2 0.000 R2229 G1 225 Y 18 34430329 V478M G A missense Het probably damaging 0.997 0.320 phenotype 10/15/2014
47 239578 UTSW Pmepa1 0.000 R2229 G1 225 Y 2 173228133 R210W G A missense Het probably damaging 1.000 0.561 phenotype 10/15/2014
48 239644 UTSW Ppp1r3c 1.000 R2229 G1 225 Y 19 36733698 R224L C A missense Het probably benign 0.000 0.090 phenotype 10/15/2014
49 239642 UTSW Prpf19 1.000 R2229 G1 207 Y 19 10897598 T39A A G missense Het probably benign 0.021 0.103 phenotype 10/15/2014
50 239602 UTSW Pwwp2b 0.082 R2229 G1 225 Y 7 139255188 C182R T C missense Het probably damaging 1.000 0.870 10/15/2014
51 239590 UTSW Rcan3 0.085 R2229 G1 225 Y 4 135425377 D11G T C missense Het probably benign 0.301 0.071 10/15/2014
52 239568 UTSW Rgsl1 0.000 R2229 G1 225 Y 1 153822358 W482L C A missense Het possibly damaging 0.719 0.085 10/15/2014
53 239645 UTSW Sfxn4 0.000 R2229 G1 225 Y 19 60851020 G200E C T missense Het probably damaging 1.000 0.909 phenotype 10/15/2014
54 239631 UTSW Slc4a8 0.186 R2229 G1 215 Y 15 100809299 I848T T C missense Het probably damaging 0.997 0.906 phenotype 10/15/2014
55 239586 UTSW Slc7a13 0.000 R2229 G1 225 Y 4 19839399 V334A T C missense Het probably benign 0.434 0.090 10/15/2014
56 239617 UTSW Smarcc2 0.906 R2229 G1 176 Y 10 128488341 A G unclassified Het probably benign 0.061 phenotype 10/15/2014
57 239591 UTSW Spata18 0.128 R2229 G1 225 Y 5 73666901 I156L A T missense Het possibly damaging 0.570 0.082 ApcMin allele leads to increased intestinal adenoma and adenocarcinoma tumor incidence and size. This double mutation and homozygous KO of the gene alone results in lower internal mitochondrial cristae density in small intestinal mucosal epithelium. [provided by MGI curators] (source: MGI)">phenotype 10/15/2014
58 239630 UTSW Spats2 0.369 R2229 G1 225 Y 15 99174453 T C critical splice donor site 2 bp Het probably null 0.959 10/15/2014
59 239596 UTSW Tas2r104 0.056 R2229 G1 225 Y 6 131685132 H205Y G A missense Het probably damaging 1.000 0.664 10/15/2014
60 239640 UTSW Tcof1 1.000 R2229 G1 225 Y 18 60832177 A G intron Het probably benign 0.093 phenotype 10/15/2014
61 239606 UTSW Tex15 0.300 R2229 G1 225 Y 8 33571237 H232N C A missense Het probably benign 0.051 0.090 phenotype 10/15/2014
62 239629 UTSW Tg 0.142 R2229 G1 225 Y 15 66674011 Q194L A T missense Het probably damaging 0.993 0.250 phenotype 10/15/2014
63 239604 UTSW Tnfrsf22 0.056 R2229 G1 225 Y 7 143644776 C T splice site 5 bp Het probably null 0.976 10/15/2014
64 239620 UTSW Trim25 0.000 R2229 G1 225 Y 11 89016621 V602E T A missense Het probably damaging 0.970 0.647 phenotype 10/15/2014
65 239577 UTSW Ttll9 0.080 R2229 G1 225 Y 2 152983063 E54G A G missense Het probably damaging 0.976 0.487 10/15/2014
66 239572 UTSW Ttn 1.000 R2229 G1 225 Y 2 76729324 T29578A T C missense Het probably damaging 0.986 0.122 phenotype 10/15/2014
67 239597 UTSW Tubgcp5 0.967 R2229 G1 143 Y 7 55830881 Q960R A G missense Het probably damaging 0.998 0.457 10/15/2014
68 239588 UTSW Ugcg 1.000 R2229 G1 225 Y 4 59207798 P46S C T missense Het probably benign 0.175 0.080 phenotype 10/15/2014
69 239579 UTSW Usp13 0.000 R2229 G1 225 Y 3 32917551 I727V A G missense Het probably benign 0.023 0.115 10/15/2014
70 239600 UTSW Vmn2r67 0.103 R2229 G1 225 Y 7 85152042 I229F T A missense Het probably benign 0.209 0.090 10/15/2014
71 239634 UTSW Vmn2r92 0.102 R2229 G1 225 Y 17 18167392 I220L A C missense Het probably benign 0.011 0.090 10/15/2014
72 239621 UTSW Wnk4 0.337 R2229 G1 225 Y 11 101275641 T A unclassified Het probably benign 0.090 phenotype 10/15/2014
73 239585 UTSW Wwp1 0.000 R2229 G1 225 Y 4 19641745 Y437N A T missense Het probably damaging 1.000 0.203 phenotype 10/15/2014
74 239573 UTSW Zdhhc5 0.396 R2229 G1 225 Y 2 84690213 I540T A G missense Het probably damaging 0.999 0.290 10/15/2014
75 239624 UTSW Zfp729b 0.128 R2229 G1 225 Y 13 67595265 I60M T C missense Het probably damaging 0.993 0.647 10/15/2014
[records 1 to 75 of 75]