Incidental Mutations

105 incidental mutations are currently displayed, and affect 105 genes.
18 are Possibly Damaging.
37 are Probably Damaging.
36 are Probably Benign.
14 are Probably Null.
1 create premature stop codons.
6 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 105] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 242189 UTSW 4930578C19Rik 0.060 R2267 G1 222 Y X 18423687 S179P A G missense Het possibly damaging 0.734 0.239 10/16/2014
2 242097 UTSW Aadac 0.000 R2267 G1 225 Y 3 60037316 D136E T A missense Het probably damaging 0.999 0.647 phenotype 10/16/2014
3 242131 UTSW Abca16 0.000 R2267 G1 225 Y 7 120431160 D165G A G missense Het probably benign 0.032 0.090 10/16/2014
4 242156 UTSW Abca8b 0.000 R2267 G1 225 Y 11 109955148 T820M G A missense Het probably benign 0.025 0.090 phenotype 10/16/2014
5 242163 UTSW Acot2 0.000 R2267 G1 225 Y 12 83990560 A216V C T missense Het probably damaging 1.000 0.318 phenotype 10/16/2014
6 242145 UTSW Agap2 0.371 R2267 G1 225 Y 10 127082428 T A splice site Het probably benign phenotype 10/16/2014
7 242165 UTSW Ak7 0.000 R2267 G1 225 Y 12 105747214 V419A T C missense Het probably benign 0.000 0.090 phenotype 10/16/2014
8 242093 UTSW Apmap 0.000 R2267 G1 225 Y 2 150588901 A G critical splice donor site 2 bp Het probably null 0.959 10/16/2014
9 242158 UTSW Apob 0.884 R2267 G1 225 Y 12 8015475 F4115S T C missense Het possibly damaging 0.740 0.420 phenotype 10/16/2014
10 242105 UTSW Cachd1 0.220 R2267 G1 225 Y 4 100949069 T A splice site Het probably benign 10/16/2014
11 242094 UTSW Ccdc39 0.348 R2267 G1 225 Y 3 33815484 E731D T A missense Het probably damaging 0.986 0.081 phenotype 10/16/2014
12 242135 UTSW Ces2a 0.060 R2267 G1 225 Y 8 104740190 I65F A T missense Het probably benign 0.021 0.090 10/16/2014
13 242110 UTSW Commd8 0.091 R2267 G1 225 Y 5 72165422 W51R A G missense Het probably damaging 0.993 0.849 phenotype 10/16/2014
14 242084 UTSW D2hgdh 0.175 R2267 G1 225 Y 1 93835435 A314V C T missense Het probably damaging 0.968 0.172 phenotype 10/16/2014
15 242111 UTSW Dcun1d4 0.174 R2267 G1 225 Y 5 73481275 T A splice site Het probably benign 0.090 10/16/2014
16 242181 UTSW Dgcr14 0.959 R2267 G1 225 Y 16 17909995 T107A T C missense Het probably damaging 0.999 0.789 phenotype 10/16/2014
17 242152 UTSW Dgke 0.190 R2267 G1 225 Y 11 89052469 E231D T A missense Het probably benign 0.001 0.061 phenotype 10/16/2014
18 314436 UTSW Dhrs9 0.113 R2267 G1 225 Y 2 69392853 A G splice site Het probably benign 0.090 phenotype 05/08/2015
19 242140 UTSW Dhx30 1.000 R2267 G1 225 Y 9 110087034 G662R C T missense Het probably damaging 0.996 0.428 phenotype 10/16/2014
20 242081 UTSW Dnah7b 0.112 R2267 G1 225 Y 1 46233915 M2401K T A missense Het probably damaging 0.996 0.450 10/16/2014
21 242157 UTSW Dnmt3a 0.289 R2267 G1 225 Y 12 3897551 T A splice site Het probably null 0.976 phenotype 10/16/2014
22 242080 UTSW Dst 0.284 R2267 G1 225 Y 1 34295466 T4874I C T missense Het probably damaging 1.000 0.094 phenotype 10/16/2014
23 242180 UTSW Eef2kmt 0.000 R2267 G1 225 Y 16 5255940 G A start gained Het probably benign 10/16/2014
24 242139 UTSW Etfa 0.371 R2267 G1 225 Y 9 55486731 L212Q A T missense Het probably damaging 1.000 0.975 phenotype 10/16/2014
25 242126 UTSW Exosc5 0.954 R2267 G1 225 Y 7 25664384 L107P T C missense Het possibly damaging 0.889 0.493 10/16/2014
26 314435 UTSW Fam117b 0.139 R2267 G1 64 Y 1 59913630 L156P T C missense Het probably damaging 0.996 0.092 05/08/2015
27 242178 UTSW Fam186b 0.000 R2267 G1 225 Y 15 99285643 D40A T G missense Het probably damaging 0.985 0.250 phenotype 10/16/2014
28 242098 UTSW Fga 0.408 R2267 G1 225 Y 3 83032950 L637P T C missense Het probably damaging 1.000 0.862 phenotype 10/16/2014
29 242114 UTSW Foxn4 1.000 R2267 G1 205 Y 5 114255601 T486A T C missense Het probably damaging 0.992 0.153 phenotype 10/16/2014
30 242119 UTSW Gcc1 0.107 R2267 G1 225 Y 6 28418499 S612P A G missense Het probably benign 0.000 0.090 phenotype 10/16/2014
31 242154 UTSW Gjd3 0.075 R2267 G1 123 N 11 98982401 V206M C T missense Het probably damaging 0.982 phenotype 10/16/2014
32 242188 UTSW Gpam 0.234 R2267 G1 225 Y 19 55072710 A T critical splice donor site 2 bp Het probably null 0.949 phenotype 10/16/2014
33 242171 UTSW Gpc6 0.180 R2267 G1 225 Y 14 117888520 A T critical splice acceptor site Het probably null 0.949 phenotype 10/16/2014
34 242162 UTSW Gphb5 0.000 R2267 G1 225 Y 12 75412946 V92L C G missense Het probably benign 0.005 0.084 phenotype 10/16/2014
35 242117 UTSW Grid2ip 0.175 R2267 G1 225 Y 5 143386092 P690L C T missense Het probably benign 0.009 0.090 phenotype 10/16/2014
36 242176 UTSW Gsdmc 0.049 R2267 G1 225 Y 15 63776798 E429G T C missense Het probably benign 0.115 0.405 10/16/2014
37 242160 UTSW Heatr5a 0.263 R2267 G1 225 Y 12 51893745 D1444G T C missense Het possibly damaging 0.677 0.184 10/16/2014
38 242166 UTSW Hist1h2bh 0.320 R2267 G1 214 Y 13 23542992 K121E T C missense Het possibly damaging 0.909 0.497 phenotype 10/16/2014
39 242086 UTSW Hmcn1 0.000 R2267 G1 225 Y 1 150599010 S4709G T C missense Het probably benign 0.001 0.115 phenotype 10/16/2014
40 242170 UTSW Hr 0.000 R2267 G1 225 Y 14 70558107 D393V A T missense Het probably benign 0.000 0.090 phenotype 10/16/2014
41 242134 UTSW Ido2 0.000 R2267 G1 175 Y 8 24535252 Y253C T C missense Het probably damaging 1.000 0.849 phenotype 10/16/2014
42 242132 UTSW Itgal 0.153 R2267 G1 225 Y 7 127306701 I352V A G missense Het possibly damaging 0.630 0.242 phenotype 10/16/2014
43 242168 UTSW Itih4 0.000 R2267 G1 225 Y 14 30892428 D445G A G missense Het probably damaging 1.000 0.928 phenotype 10/16/2014
44 242183 UTSW Kcnh8 0.000 R2267 G1 175 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 10/16/2014
45 242085 UTSW Kcnt2 0.105 R2267 G1 225 Y 1 140573683 G A splice site 5 bp Het probably null 0.976 phenotype 10/16/2014
46 242128 UTSW Klk1b21 0.050 R2267 G1 225 Y 7 44104439 I49T T C missense Het possibly damaging 0.506 0.179 phenotype 10/16/2014
47 242124 UTSW Klrb1 0.000 R2267 G1 225 Y 6 128722974 S25T A T missense Het probably damaging 1.000 0.100 phenotype 10/16/2014
48 242142 UTSW L3mbtl3 1.000 R2267 G1 225 Y 10 26331857 W321* C T nonsense Het probably null 0.976 phenotype 10/16/2014
49 242143 UTSW Lama2 0.532 R2267 G1 225 Y 10 26992936 I2838F T A missense Het probably damaging 1.000 0.172 phenotype 10/16/2014
50 242121 UTSW Lrrtm1 0.000 R2267 G1 225 Y 6 77244013 A151E C A missense Het probably damaging 0.971 0.094 phenotype 10/16/2014
51 242159 UTSW Lsmem1 0.059 R2267 G1 217 Y 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 10/16/2014
52 242100 UTSW Magi3 0.409 R2267 G1 225 Y 3 104021066 G A intron Het probably benign 10/16/2014
53 242187 UTSW Mamdc2 0.115 R2267 G1 225 Y 19 23303903 A T splice site Het probably benign 10/16/2014
54 242184 UTSW Mcc 0.000 R2267 G1 225 Y 18 44519541 D272G T C missense Het probably damaging 0.992 0.131 phenotype 10/16/2014
55 242088 UTSW Mgst3 0.000 R2267 G1 225 Y 1 167373799 T106S T A missense Het probably benign 0.229 0.099 phenotype 10/16/2014
56 242149 UTSW Mink1 0.000 R2267 G1 225 Y 11 70601724 G A splice site Het probably null 0.976 phenotype 10/16/2014
57 242164 UTSW Mlh3 0.000 R2267 G1 225 Y 12 85260811 H1181N G T missense Het possibly damaging 0.550 0.138 phenotype 10/16/2014
58 242169 UTSW Mmrn2 0.055 R2267 G1 225 Y 14 34399492 K773R A G missense Het probably benign 0.407 0.062 phenotype 10/16/2014
59 242155 UTSW Mrc2 0.000 R2267 G1 225 Y 11 105348431 G A splice site 5 bp Het probably null 0.976 phenotype 10/16/2014
60 242185 UTSW Mro 0.000 R2267 G1 225 Y 18 73873297 I104T T C missense Het probably benign 0.195 0.489 phenotype 10/16/2014
61 242174 UTSW Mtbp 1.000 R2267 G1 225 Y 15 55569160 G A critical splice donor site 1 bp Het probably null 0.072 phenotype 10/16/2014
62 242136 UTSW Mtss1l 0.000 R2267 G1 225 Y 8 110728730 K92E A G missense Het possibly damaging 0.803 0.130 10/16/2014
63 242101 UTSW Mybphl 0.059 R2267 G1 224 Y 3 108365001 E2G A G missense Het probably damaging 0.999 0.087 phenotype 10/16/2014
64 242082 UTSW Nbeal1 0.000 R2267 G1 225 Y 1 60330878 T A splice site Het probably benign 0.090 10/16/2014
65 242153 UTSW Neurod2 0.823 R2267 G1 147 Y 11 98327756 C194F C A missense Het probably damaging 0.999 0.566 phenotype 10/16/2014
66 242091 UTSW Nr4a2 1.000 R2267 G1 225 Y 2 57112006 D145V T A missense Het possibly damaging 0.766 0.114 phenotype 10/16/2014
67 242089 UTSW Ntmt1 0.330 R2267 G1 211 Y 2 30820460 N58K C A missense Het probably benign 0.241 0.101 phenotype 10/16/2014
68 242120 UTSW Nup205 0.962 R2267 G1 225 Y 6 35241349 S1819P T C missense Het possibly damaging 0.669 0.118 phenotype 10/16/2014
69 242083 UTSW Obsl1 0.196 R2267 G1 185 Y 1 75505698 H176R T C missense Het probably damaging 1.000 0.186 10/16/2014
70 242130 UTSW Olfr583 0.165 R2267 G1 225 Y 7 103052137 V280I G A missense Het probably benign 0.001 0.085 phenotype 10/16/2014
71 242137 UTSW Olfr836 0.154 R2267 G1 225 Y 9 19121441 H162L A T missense Het probably benign 0.222 phenotype 10/16/2014
72 242138 UTSW Olfr926 0.083 R2267 G1 225 Y 9 38878063 T296A A G missense Het probably benign 0.002 0.090 phenotype 10/16/2014
73 242096 UTSW P2ry13 0.000 R2267 G1 225 Y 3 59210028 M110V T C missense Het probably damaging 0.999 0.223 phenotype 10/16/2014
74 242095 UTSW P2ry14 0.000 R2267 G1 225 Y 3 59115571 N165S T C missense Het probably damaging 1.000 0.415 phenotype 10/16/2014
75 242190 UTSW Phka1 0.000 R2267 G1 222 Y X 102541110 A G critical splice donor site Het probably benign 0.091 phenotype 10/16/2014
76 242123 UTSW Plxnd1 1.000 R2267 G1 225 Y 6 115962743 V1425A A G missense Het probably benign 0.290 0.135 phenotype 10/16/2014
77 242146 UTSW Ppp2ca 1.000 R2267 G1 225 Y 11 52118086 G138R G A missense Het probably damaging 1.000 0.937 phenotype 10/16/2014
78 242108 UTSW Ptpn12 1.000 R2267 G1 225 Y 5 20998411 N456K A T missense Het probably damaging 0.977 0.102 phenotype 10/16/2014
79 242116 UTSW Scarb1 0.000 R2267 G1 225 Y 5 125287375 S97T A T missense Het possibly damaging 0.817 0.113 phenotype 10/16/2014
80 242186 UTSW Scyl1 0.918 R2267 G1 225 Y 19 5761721 D440N C T missense Het possibly damaging 0.778 0.179 phenotype 10/16/2014
81 242172 UTSW Sema5a 1.000 R2267 G1 225 Y 15 32574919 T391K C A missense Het probably benign 0.025 0.101 phenotype 10/16/2014
82 242127 UTSW Sipa1l3 0.754 R2267 G1 187 Y 7 29399602 N414I T A missense Het probably damaging 1.000 0.394 phenotype 10/16/2014
83 242107 UTSW Skint6 0.056 R2267 G1 225 Y 4 112842822 T C splice site 83 bp Het probably null 0.976 10/16/2014
84 242102 UTSW Slc35a3 0.102 R2267 G1 225 Y 3 116673636 K325E T C missense Het possibly damaging 0.871 0.104 phenotype 10/16/2014
85 242099 UTSW Spag17 0.000 R2267 G1 225 Y 3 100061866 C A splice site Het probably null 0.976 phenotype 10/16/2014
86 242129 UTSW Spib 0.806 R2267 G1 212 Y 7 44528924 M141L T A missense Het probably benign 0.000 0.090 phenotype 10/16/2014
87 242148 UTSW Srebf1 1.000 R2267 G1 225 Y 11 60207147 S44P A G missense Het probably damaging 0.991 0.063 phenotype 10/16/2014
88 242125 UTSW Styk1 0.309 R2267 G1 225 Y 6 131312576 E25G T C missense Het probably benign 0.011 0.109 phenotype 10/16/2014
89 242141 UTSW Taar8b 0.118 R2267 G1 225 Y 10 24091372 N308S T C missense Het probably damaging 0.987 0.836 10/16/2014
90 242151 UTSW Taf15 0.928 R2267 G1 225 Y 11 83497262 S200R T G missense Het probably damaging 0.976 0.135 phenotype 10/16/2014
91 242092 UTSW Tanc1 0.000 R2267 G1 225 N 2 59837219 G A critical splice donor site 1 bp Het probably null phenotype 10/16/2014
92 242090 UTSW Tas2r134 0.052 R2267 G1 225 Y 2 51628237 T243A A G missense Het probably benign 0.006 0.090 10/16/2014
93 242175 UTSW Tatdn1 0.216 R2267 G1 225 Y 15 58905752 M218K A T missense Het probably damaging 0.996 0.940 10/16/2014
94 242109 UTSW Tbc1d14 1.000 R2267 G1 225 Y 5 36543217 L269P A G missense Het possibly damaging 0.523 0.075 phenotype 10/16/2014
95 242182 UTSW Tbx1 1.000 R2267 G1 83 Y 16 18581994 T C splice site 4550 bp Het probably null 0.976 phenotype 10/16/2014
96 242133 UTSW Tgfbr3l 0.000 R2267 G1 225 Y 8 4250506 E228G A G missense Het probably benign 0.007 0.069 10/16/2014
97 242115 UTSW Tmem233 0.054 R2267 G1 225 Y 5 116051458 G C splice site Het probably benign 10/16/2014
98 242112 UTSW Tmprss11d 0.070 R2267 G1 225 Y 5 86373349 Y2H A G missense Het probably benign 0.006 0.071 phenotype 10/16/2014
99 242173 UTSW Trps1 1.000 R2267 G1 225 Y 15 50822398 R544C G A missense Het probably damaging 1.000 0.293 phenotype 10/16/2014
100 242106 UTSW Ttc22 0.059 R2267 G1 225 Y 4 106639085 V444A T C missense Het possibly damaging 0.597 0.179 phenotype 10/16/2014
[records 1 to 100 of 105] next >> last >|