Incidental Mutations

35 incidental mutations are currently displayed, and affect 35 genes.
4 are Possibly Damaging.
14 are Probably Damaging.
11 are Probably Benign.
6 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 35 of 35] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 248169 UTSW 1700008O03Rik 0.185 R2372 G1 205 Y 7 44360280 L135S A G missense Het probably damaging 0.999 0.647 11/11/2014
2 248167 UTSW A2ml1 0.000 R2372 G1 225 Y 6 128580386 A115T C T missense Het probably benign 0.006 0.090 11/11/2014
3 248149 UTSW Alpi 0.156 R2372 G1 225 Y 1 87100594 T169N G T missense Het probably damaging 0.997 0.647 phenotype 11/11/2014
4 248173 UTSW Ccdc15 0.105 R2372 G1 225 Y 9 37315505 D378G T C missense Het possibly damaging 0.640 0.059 11/11/2014
5 248179 UTSW Cpb2 0.142 R2372 G1 225 Y 14 75268050 V162G T G missense Het probably damaging 0.966 0.566 phenotype 11/11/2014
6 248186 UTSW Dnmbp 0.000 R2372 G1 225 Y 19 43902320 E336G T C missense Het probably benign 0.007 0.071 phenotype 11/11/2014
7 248184 UTSW Dok6 0.058 R2372 G1 225 Y 18 89414864 R274G G C missense Het probably null 0.002 0.165 phenotype 11/11/2014
8 248181 UTSW Eef1d 0.229 R2372 G1 225 Y 15 75896317 R199C G A missense Het probably damaging 0.999 0.647 phenotype 11/11/2014
9 248158 UTSW Epha8 0.000 R2372 G1 225 Y 4 136933010 Y714C T C missense Het probably damaging 1.000 0.724 phenotype 11/11/2014
10 248180 UTSW Fyb 0.000 R2372 G1 225 Y 15 6651907 T C splice site Het probably benign 0.090 phenotype 11/11/2014
11 248177 UTSW Gfpt2 0.000 R2372 G1 225 Y 11 49807715 N46D A G missense Het probably benign 0.002 0.075 11/11/2014
12 248176 UTSW Gm10608 0.082 R2372 G1 145 Y 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA small deletion Het probably benign 0.090 11/11/2014
13 248178 UTSW Gm11596 0.094 R2372 G1 225 Y 11 99793256 E13* C A nonsense Het probably null 0.976 11/11/2014
14 248162 UTSW Gsx2 1.000 R2372 G1 225 Y 5 75077052 F222L T C missense Het probably damaging 0.999 0.963 phenotype 11/11/2014
15 248157 UTSW Hpca 0.305 R2372 G1 225 Y 4 129118444 K100* T A nonsense Het probably null 0.975 phenotype 11/11/2014
16 248166 UTSW Iqsec1 0.144 R2372 G1 209 Y 6 90694654 S89P A G missense Het probably damaging 0.999 0.062 phenotype 11/11/2014
17 248154 UTSW Kif12 0.381 R2372 G1 225 Y 4 63168559 T347S T A missense Het possibly damaging 0.637 0.268 phenotype 11/11/2014
18 248170 UTSW Knop1 0.000 R2372 G1 225 Y 7 118853217 L93S A G missense Het probably damaging 1.000 0.438 phenotype 11/11/2014
19 248183 UTSW Mib1 1.000 R2372 G1 225 Y 18 10812045 T981A A G missense Het probably damaging 0.999 0.117 phenotype 11/11/2014
20 248164 UTSW N4bp2l1 0.084 R2372 G1 225 Y 5 150572781 E123K C T missense Het probably damaging 0.999 0.191 11/11/2014
21 248153 UTSW Npr2 0.676 R2372 G1 225 Y 4 43650432 R976W C T missense Het probably damaging 1.000 0.647 phenotype 11/11/2014
22 248161 UTSW Rbpj 1.000 R2372 G1 225 Y 5 53642195 T C splice site Het probably benign phenotype 11/11/2014
23 248165 UTSW Ruvbl1 0.970 R2372 G1 225 Y 6 88485797 V301A T C missense Het possibly damaging 0.532 0.510 phenotype 11/11/2014
24 248155 UTSW Sgip1 0.000 R2372 G1 225 Y 4 102909791 T C critical splice donor site 2 bp Het probably null 0.948 phenotype 11/11/2014
25 248160 UTSW Sh3bp2 0.000 R2372 G1 225 Y 5 34559496 I361T T C missense Het probably benign 0.001 0.060 phenotype 11/11/2014
26 248156 UTSW Skint1 0.100 R2372 G1 225 Y 4 112019151 Y90N T A missense Het probably damaging 1.000 0.647 phenotype 11/11/2014
27 248185 UTSW Slc25a45 0.085 R2372 G1 225 Y 19 5884552 V183I G A missense Het probably benign 0.002 0.090 phenotype 11/11/2014
28 248150 UTSW Slco4c1 0.192 R2372 G1 225 Y 1 96821200 H664L T A missense Het probably benign 0.004 0.069 phenotype 11/11/2014
29 248168 UTSW Sult2a4 0.066 R2372 G1 225 Y 7 13915300 I194L T A missense Het probably benign 0.154 0.209 phenotype 11/11/2014
30 248174 UTSW Tecta 0.102 R2372 G1 225 Y 9 42388274 D173Y C A missense Het probably damaging 1.000 0.730 phenotype 11/11/2014
31 248163 UTSW Tnrc18 0.611 R2372 G1 225 Y 5 142759704 T A splice site Het probably benign 0.090 11/11/2014
32 248151 UTSW Trove2 0.274 R2372 G1 225 Y 1 143770882 E42* C A nonsense Het probably null 0.976 phenotype 11/11/2014
33 248172 UTSW Use1 1.000 R2372 G1 225 Y 8 71369179 L169P T C missense Het possibly damaging 0.956 0.907 phenotype 11/11/2014
34 248152 UTSW Zfp335 1.000 R2372 G1 225 Y 2 164895039 L918P A G missense Het probably damaging 0.999 0.740 phenotype 11/11/2014
35 248148 UTSW Zfp451 0.000 R2372 G1 225 Y 1 33780052 A T splice site Het probably null 0.976 11/11/2014
[records 1 to 35 of 35]