Incidental Mutations

26 incidental mutations are currently displayed, and affect 26 genes.
3 are Possibly Damaging.
12 are Probably Damaging.
8 are Probably Benign.
3 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 26 of 26] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 249735 UTSW 2210407C18Rik 0.055 R2439 G1 225 N 11 58610777 (GRCm38) C127R A G missense Het probably damaging 1.000 2014-11-12
2 249724 UTSW Atp11b 0.260 R2439 G1 225 N 3 35814084 (GRCm38) T635K C A missense Het possibly damaging 0.679 phenotype 2014-11-12
3 249720 UTSW B4galt3 0.328 R2439 G1 225 N 1 171274043 (GRCm38) H196N C A missense Het probably damaging 1.000 0.568 phenotype 2014-11-12
4 249744 UTSW Btla 0.050 R2439 G1 225 N 16 45239140 (GRCm38) C69F G T missense Het probably damaging 1.000 phenotype 2014-11-12
5 249743 UTSW Cdh10 0.080 R2439 G1 225 N 15 19013398 (GRCm38) L695V T G missense Het probably damaging 0.999 phenotype 2014-11-12
6 476262 UTSW Cfap44 0.000 R2439 G1 225 N 16 44481246 (GRCm38) C T unclassified Het probably benign phenotype 2017-05-11
7 249718 UTSW Dock10 0.303 R2439 G1 225 N 1 80532432 (GRCm38) N1560H T G missense Het probably damaging 0.999 phenotype 2014-11-12
8 249729 UTSW Ephb6 0.733 R2439 G1 218 N 6 41618735 (GRCm38) H809Q C A missense Het probably benign 0.306 phenotype 2014-11-12
9 249721 UTSW Eprs 1.000 R2439 G1 225 N 1 185379742 (GRCm38) G A splice site 5 bp Het probably null 0.976 phenotype 2014-11-12
10 249738 UTSW Gdf7 0.850 R2439 G1 225 N 12 8298050 (GRCm38) S416P A G missense Het probably damaging 0.999 phenotype 2014-11-12
11 249725 UTSW Ints8 0.964 R2439 G1 225 N 4 11225725 (GRCm38) M611V T C missense Het probably benign 0.288 phenotype 2014-11-12
12 249732 UTSW Micalcl 0.000 R2439 G1 225 N 7 112394795 (GRCm38) E504G A G missense Het probably damaging 0.987 2014-11-12
13 249740 UTSW Mrps30 0.928 R2439 G1 225 N 13 118385272 (GRCm38) P231S G A missense Het probably damaging 1.000 phenotype 2014-11-12
14 249723 UTSW Nr1h3 0.000 R2439 G1 225 N 2 91190220 (GRCm38) D256G T C missense Het probably benign 0.449 phenotype 2014-11-12
15 249726 UTSW Pramel5 0.104 R2439 G1 225 N 4 144273740 (GRCm38) M89V T C missense Het probably benign 0.012 2014-11-12
16 249731 UTSW Psg18 0.051 R2439 G1 225 N 7 18346119 (GRCm38) T386A T C missense Het probably benign 0.240 2014-11-12
17 249719 UTSW Ptprc 0.000 R2439 G1 225 N 1 138066152 (GRCm38) V1180A A G missense Het possibly damaging 0.670 phenotype 2014-11-12
18 249730 UTSW Rassf8 0.806 R2439 G1 225 N 6 145815334 (GRCm38) S129P T C missense Het probably damaging 1.000 phenotype 2014-11-12
19 249734 UTSW Rbm6 0.933 R2439 G1 225 N 9 107779597 (GRCm38) Y994H A G missense Het probably damaging 0.999 2014-11-12
20 249722 UTSW Setx 0.000 R2439 G1 217 N 2 29154061 (GRCm38) 1814 GTGGCT GT frame shift Het probably null 0.976 phenotype 2014-11-12
21 249737 UTSW Slc2a4 0.609 R2439 G1 225 N 11 69945625 (GRCm38) F222S A G missense Het possibly damaging 0.925 phenotype 2014-11-12
22 249745 UTSW Smarca2 0.000 R2439 G1 225 N 19 26691454 (GRCm38) T C critical splice donor site 2 bp Het probably null phenotype 2014-11-12
23 249742 UTSW Tmtc4 0.000 R2439 G1 225 N 14 122971903 (GRCm38) N110T T G missense Het probably damaging 1.000 2014-11-12
24 249741 UTSW Tsc22d1 0.280 R2439 G1 105 N 14 76417267 (GRCm38) TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA unclassified Het probably benign phenotype 2014-11-12
25 249728 UTSW Umad1 0.116 R2439 G1 225 N 6 8427078 (GRCm38) D110E T A missense Het probably damaging 0.999 2014-11-12
26 249739 UTSW Ylpm1 1.000 R2439 G1 210 N 12 85014117 (GRCm38) A G unclassified Het probably benign 2014-11-12
[records 1 to 26 of 26]