Incidental Mutations

78 incidental mutations are currently displayed, and affect 77 genes.
16 are Possibly Damaging.
27 are Probably Damaging.
26 are Probably Benign.
9 are Probably Null.
0 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 78 of 78] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 266157 UTSW 1700020N01Rik 0.059 R2507 G1 224 N 10 21621782 A G utr 3 prime Het probably benign 02/05/2015
2 476446 UTSW 4930535I16Rik R2507 G1 189 N 4 123917947 G A intron Het probably benign 05/11/2017
3 251318 UTSW Akr1b3 0.345 R2507 G1 225 N 6 34310064 E186K C T missense Het probably damaging 0.998 phenotype 12/04/2014
4 251417 UTSW Apc 0.967 R2507 G1 225 N 18 34316537 N2128I A T missense Het possibly damaging 0.774 phenotype 12/04/2014
5 251269 UTSW Api5 0.881 R2507 G1 225 N 2 94429817 I31M T C missense Het probably damaging 1.000 phenotype 12/04/2014
6 251423 UTSW Armcx4 0.138 R2507 G1 222 N X 134695379 V2012G T G missense Het possibly damaging 0.861 phenotype 12/04/2014
7 251285 UTSW Aurka 1.000 R2507 G1 225 N 2 172370445 E4G T C missense Het probably benign 0.002 phenotype 12/04/2014
8 251281 UTSW B4galt5 1.000 R2507 G1 225 N 2 167306638 M187L T A missense Het probably benign 0.286 phenotype 12/04/2014
9 251362 UTSW Bsn 0.223 R2507 G1 225 N 9 108116114 D813G T C missense Het probably damaging 0.997 phenotype 12/04/2014
10 251277 UTSW Bub1 1.000 R2507 G1 225 N 2 127801423 D1000E A T missense Het probably benign 0.039 phenotype 12/04/2014
11 251298 UTSW C87499 0.311 R2507 G1 225 N 4 88629211 K161N T A missense Het possibly damaging 0.890 12/04/2014
12 251421 UTSW Cacna1f 0.000 R2507 G1 222 N X 7626448 T G unclassified Het probably null phenotype 12/04/2014
13 251403 UTSW Cdh6 0.544 R2507 G1 225 N 15 13041361 I539T A G missense Het probably benign 0.103 phenotype 12/04/2014
14 251384 UTSW Cdhr3 0.069 R2507 G1 225 N 12 33038915 D756G T C missense Het probably benign 0.000 12/04/2014
15 251401 UTSW Cenph 1.000 R2507 G1 225 N 13 100771236 D85E A T missense Het probably benign 0.003 phenotype 12/04/2014
16 251342 UTSW Chd9 0.000 R2507 G1 225 N 8 91033987 P2120L C T missense Het probably benign 0.015 0.061 12/04/2014
17 251324 UTSW Clec2h 0.058 R2507 G1 225 N 6 128673982 N75S A G missense Het probably benign 0.018 12/04/2014
18 251312 UTSW Cnga1 0.306 R2507 G1 225 N 5 72619061 V20I C T missense Het possibly damaging 0.845 0.101 phenotype 12/04/2014
19 251346 UTSW Cox4i1 1.000 R2507 G1 225 N 8 120673290 V51E T A missense Het possibly damaging 0.946 phenotype 12/04/2014
20 251293 UTSW Cpne3 0.193 R2507 G1 225 N 4 19553871 N53K A T missense Het probably damaging 1.000 phenotype 12/04/2014
21 251407 UTSW Cpt1b 1.000 R2507 G1 225 N 15 89419098 F585L A G missense Het probably benign 0.078 phenotype 12/04/2014
22 251390 UTSW Daam1 1.000 R2507 G1 225 N 12 71975223 D732N G A missense Het probably damaging 0.999 phenotype 12/04/2014
23 251262 UTSW Dner 0.000 R2507 G1 225 N 1 84583080 C115S A T missense Het probably damaging 1.000 phenotype 12/04/2014
24 251360 UTSW Dopey1 0.218 R2507 G1 225 N 9 86513117 F759Y T A missense Het probably damaging 0.999 12/04/2014
25 251250 UTSW Dst 0.417 R2507 G1 225 N 1 34011909 Y29H T C missense Het probably damaging 0.982 phenotype 12/04/2014
26 251252 UTSW Dst 0.417 R2507 G1 225 N 1 34188417 V1875A T C missense Het possibly damaging 0.845 phenotype 12/04/2014
27 251275 UTSW Duox1 0.000 R2507 G1 225 N 2 122333138 D817G A G missense Het probably benign 0.338 phenotype 12/04/2014
28 251405 UTSW Emc2 0.878 R2507 G1 225 N 15 43511698 A T critical splice acceptor site Het probably null 12/04/2014
29 251291 UTSW Erich3 0.000 R2507 G1 225 N 3 154698659 E51V A T missense Het probably null 1.000 12/04/2014
30 251396 UTSW Exoc2 0.939 R2507 G1 225 N 13 30882365 Y443H A G missense Het possibly damaging 0.553 phenotype 12/04/2014
31 251380 UTSW Fbf1 0.000 R2507 G1 225 N 11 116155426 R200G T C missense Het probably benign 0.000 12/04/2014
32 251378 UTSW Fdxr 0.938 R2507 G1 219 N 11 115271980 T100I G A missense Het probably damaging 0.981 phenotype 12/04/2014
33 251303 UTSW Galnt11 0.177 R2507 G1 225 N 5 25247612 P41A C G missense Het probably damaging 1.000 12/04/2014
34 251372 UTSW Galnt4 0.000 R2507 G1 225 N 10 99109286 K291R A G missense Het possibly damaging 0.780 phenotype 12/04/2014
35 251300 UTSW Gm12695 0.065 R2507 G1 225 N 4 96754189 E301V T A missense Het probably damaging 0.991 12/04/2014
36 251368 UTSW Gopc 0.367 R2507 G1 225 N 10 52353326 C T critical splice donor site 1 bp Het probably null phenotype 12/04/2014
37 251376 UTSW Gria1 0.000 R2507 G1 225 N 11 57289320 T699S A T missense Het probably null 0.299 phenotype 12/04/2014
38 251334 UTSW Gsr 0.144 R2507 G1 225 N 8 33680288 D200E T G missense Het probably benign 0.451 phenotype 12/04/2014
39 251258 UTSW Ikzf2 0.000 R2507 G1 225 N 1 69539288 A282V G A missense Het probably benign 0.107 phenotype 12/04/2014
40 251322 UTSW Irak2 0.000 R2507 G1 225 N 6 113647678 I45T T C missense Het probably damaging 1.000 phenotype 12/04/2014
41 251400 UTSW Irx1 1.000 R2507 G1 225 N 13 71959820 K248E T C missense Het probably damaging 0.966 phenotype 12/04/2014
42 251382 UTSW Kcns3 0.143 R2507 G1 225 N 12 11092086 V204G A C missense Het possibly damaging 0.666 phenotype 12/04/2014
43 251330 UTSW Lmo1 0.780 R2507 G1 133 N 7 109140641 M91I C A missense Het probably damaging 1.000 phenotype 12/04/2014
44 251348 UTSW Map3k21 0.312 R2507 G1 225 N 8 125939938 D623G A G missense Het possibly damaging 0.729 12/04/2014
45 251364 UTSW Map4 0.000 R2507 G1 225 N 9 110037483 A G intron Het probably benign phenotype 12/04/2014
46 251394 UTSW Mark3 0.170 R2507 G1 225 N 12 111627242 V236E T A missense Het probably damaging 1.000 phenotype 12/04/2014
47 251366 UTSW Med23 1.000 R2507 G1 225 N 10 24910813 D939G A G missense Het probably damaging 1.000 phenotype 12/04/2014
48 251326 UTSW Mrgpra9 0.055 R2507 G1 225 N 7 47235494 C142R A G missense Het possibly damaging 0.627 12/04/2014
49 251310 UTSW N4bp2 0.167 R2507 G1 225 N 5 65790061 D11E T A missense Het probably benign 0.006 phenotype 12/04/2014
50 251267 UTSW Ntng2 0.264 R2507 G1 225 N 2 29207519 N310S T C missense Het probably damaging 0.999 phenotype 12/04/2014
51 251302 UTSW Olfr1328 0.104 R2507 G1 225 N 4 118933925 M308V T C missense Het probably benign 0.000 phenotype 12/04/2014
52 251263 UTSW Olfr1414 0.087 R2507 G1 225 N 1 92511378 S217P A G missense Het probably damaging 1.000 phenotype 12/04/2014
53 251314 UTSW Pcolce 0.129 R2507 G1 225 N 5 137607051 V260A A G missense Het possibly damaging 0.925 phenotype 12/04/2014
54 251316 UTSW Pds5b 1.000 R2507 G1 225 N 5 150756428 T533K C A missense Het possibly damaging 0.897 phenotype 12/04/2014
55 251260 UTSW Pecr 0.112 R2507 G1 225 N 1 72261976 Y268H A G missense Het probably benign 0.106 12/04/2014
56 251419 UTSW Phax 0.944 R2507 G1 225 N 18 56586884 F299Y T A missense Het probably damaging 0.963 12/04/2014
57 251358 UTSW Phip 1.000 R2507 G1 225 N 9 82915339 H537R T C missense Het possibly damaging 0.947 0.497 phenotype 12/04/2014
58 251388 UTSW Prpf39 0.938 R2507 G1 225 N 12 65057815 F551L T A missense Het probably benign 0.358 12/04/2014
59 251398 UTSW Ptch1 1.000 R2507 G1 222 N 13 63524959 E944A T G missense Het probably benign 0.003 0.137 phenotype 12/04/2014
60 251386 UTSW Ralgapa1 0.809 R2507 G1 225 N 12 55718201 P889S G A missense Het probably damaging 1.000 phenotype 12/04/2014
61 251273 UTSW Rpap1 0.962 R2507 G1 225 N 2 119780054 A G critical splice donor site 2 bp Het probably null phenotype 12/04/2014
62 476447 UTSW Rufy3 1.000 R2507 G1 225 N 5 88649898 S645P T C missense Het probably damaging 0.998 phenotype 05/11/2017
63 251338 UTSW Samd1 0.898 R2507 G1 119 N 8 83998996 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA unclassified Het probably benign 12/04/2014
64 476451 UTSW Spata7 0.161 R2507 G1 225 N 12 98658450 A172S G T missense Het probably benign 0.000 phenotype 05/11/2017
65 251279 UTSW Stk35 0.000 R2507 G1 225 N 2 129801515 T140A A G missense Het probably damaging 0.966 phenotype 12/04/2014
66 251370 UTSW Thop1 0.536 R2507 G1 85 N 10 81070264 M1R T G start codon destroyed Het probably null 0.465 phenotype 12/04/2014
67 251308 UTSW Tlr1 0.000 R2507 G1 225 N 5 64925296 Y646C T C missense Het probably damaging 1.000 phenotype 12/04/2014
68 251254 UTSW Tpp2 0.617 R2507 G1 225 N 1 44001449 Y290C A G missense Het probably benign 0.306 phenotype 12/04/2014
69 251265 UTSW Tpr 1.000 R2507 G1 225 N 1 150392944 M1V A G start codon destroyed Het probably null phenotype 12/04/2014
70 251328 UTSW Trim6 0.402 R2507 G1 225 N 7 104228185 F161L T C missense Het probably damaging 0.999 phenotype 12/04/2014
71 251354 UTSW Ubash3b 0.211 R2507 G1 105 N 9 41157354 K25E T C missense Het possibly damaging 0.901 phenotype 12/04/2014
72 266158 UTSW Unc45b 1.000 R2507 G1 189 N 11 82940137 G A intron Het probably null phenotype 02/05/2015
73 251256 UTSW Unc80 0.895 R2507 G1 225 N 1 66612107 N1537S A G missense Het possibly damaging 0.528 phenotype 12/04/2014
74 251344 UTSW Usb1 0.105 R2507 G1 225 N 8 95343124 F100S T C missense Het probably damaging 0.999 phenotype 12/04/2014
75 251320 UTSW Vmn1r17 0.371 R2507 G1 225 N 6 57361259 L40F C A missense Het probably damaging 0.993 12/04/2014
76 251413 UTSW Vmn1r233 0.062 R2507 G1 225 N 17 20993848 M280K A T missense Het probably benign 0.294 12/04/2014
77 251296 UTSW Zfp37 0.323 R2507 G1 225 N 4 62191256 C524S A T missense Het probably damaging 1.000 phenotype 12/04/2014
78 251350 UTSW Zfp426 0.086 R2507 G1 225 N 9 20470431 K420R T C missense Het probably benign 0.002 phenotype 12/04/2014
[records 1 to 78 of 78]