Incidental Mutations

79 incidental mutations are currently displayed, and affect 78 genes.
15 are Possibly Damaging.
30 are Probably Damaging.
20 are Probably Benign.
12 are Probably Null.
5 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 79 of 79] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 254480 UTSW 2010315B03Rik 0.068 R2566 G1 171 N 9 124293071 K408E T C missense Het probably damaging 0.974 12/04/2014
2 254481 UTSW 2010315B03Rik 0.068 R2566 G1 118 N 9 124293153 K380N T A missense Het probably damaging 0.991 12/04/2014
3 476641 UTSW 9230104M06Rik R2566 G1 209 N 12 113000739 C T unclassified Het probably benign 05/11/2017
4 254482 UTSW Ahi1 0.814 R2566 G1 225 N 10 20970911 C413* T A nonsense Het probably null phenotype 12/04/2014
5 254464 UTSW Alms1 0.000 R2566 G1 225 N 6 85622482 M1430K T A missense Het possibly damaging 0.838 phenotype 12/04/2014
6 254485 UTSW Ankrd52 0.953 R2566 G1 156 N 10 128389351 A894S G T missense Het probably benign 0.388 12/04/2014
7 254467 UTSW Arhgap33 0.165 R2566 G1 225 N 7 30527229 V494L C A missense Het probably damaging 0.995 phenotype 12/04/2014
8 254430 UTSW Atic 0.966 R2566 G1 225 N 1 71568971 V275F G T missense Het probably damaging 0.979 phenotype 12/04/2014
9 254462 UTSW Atoh1 1.000 R2566 G1 225 N 6 64729684 V121E T A missense Het probably damaging 0.999 phenotype 12/04/2014
10 254492 UTSW Atp5h 0.526 R2566 G1 225 N 11 115416038 T A unclassified Het probably null phenotype 12/04/2014
11 254508 UTSW Baiap2l2 0.000 R2566 G1 91 N 15 79261974 A T splice site Het probably null phenotype 12/04/2014
12 254459 UTSW Brca2 1.000 R2566 G1 225 N 5 150541762 T1664S A T missense Het probably benign 0.029 phenotype 12/04/2014
13 254475 UTSW Cdh15 0.000 R2566 G1 225 N 8 122862024 R279Q G A missense Het probably damaging 0.998 0.020 phenotype 12/04/2014
14 254446 UTSW Celf3 0.249 R2566 G1 140 N 3 94488230 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 12/04/2014
15 254435 UTSW Cep350 0.961 R2566 G1 225 N 1 155959718 A T critical splice donor site 2 bp Het probably null phenotype 12/04/2014
16 254473 UTSW Ces2g 0.050 R2566 G1 225 N 8 104965989 T C critical splice donor site 2 bp Het probably null 12/04/2014
17 254505 UTSW Csmd3 0.000 R2566 G1 217 N 15 47741236 CCTTTGCGCTT CCTT frame shift Het probably null 0.653 12/04/2014
18 254509 UTSW Cyp2d34 0.076 R2566 G1 225 N 15 82616167 F457S A G missense Het probably damaging 1.000 12/04/2014
19 254453 UTSW Disp3 0.000 R2566 G1 225 N 4 148241423 T1293S T A missense Het probably damaging 0.998 12/04/2014
20 254431 UTSW Dock10 0.255 R2566 G1 225 N 1 80540253 I1348F T A missense Het possibly damaging 0.881 phenotype 12/04/2014
21 254495 UTSW Dsp 1.000 R2566 G1 225 N 13 38196404 H1776L A T missense Het probably damaging 0.997 phenotype 12/04/2014
22 254432 UTSW Efhd1 0.000 R2566 G1 225 N 1 87309755 Q228L A T missense Het possibly damaging 0.719 phenotype 12/04/2014
23 254439 UTSW Entpd2 0.118 R2566 G1 215 N 2 25399283 I259N T A missense Het probably benign 0.155 phenotype 12/04/2014
24 254499 UTSW Fam149b 0.267 R2566 G1 225 N 14 20375510 M138L A T missense Het probably damaging 0.971 12/04/2014
25 254441 UTSW Fastkd5 0.774 R2566 G1 225 N 2 130616365 K102E T C missense Het probably benign 0.003 12/04/2014
26 254429 UTSW Fzd7 0.358 R2566 G1 222 N 1 59484536 T526K C A missense Het possibly damaging 0.839 phenotype 12/04/2014
27 254456 UTSW G6pd2 0.000 R2566 G1 225 N 5 61808987 I35N T A missense Het probably damaging 0.996 12/04/2014
28 254461 UTSW Gars 1.000 R2566 G1 225 N 6 55065563 M427K T A missense Het probably damaging 1.000 phenotype 12/04/2014
29 254460 UTSW Gimap4 0.052 R2566 G1 225 N 6 48690865 R57C C T missense Het probably damaging 1.000 phenotype 12/04/2014
30 254450 UTSW Gm11232 0.065 R2566 G1 225 N 4 71757785 W41L C A missense Het probably benign 0.002 12/04/2014
31 254465 UTSW Gm15737 R2566 G1 225 N 6 92879720 C43* T A nonsense Het probably null phenotype 12/04/2014
32 254452 UTSW Gm853 0.095 R2566 G1 181 N 4 130209888 L420Q A T missense Het probably benign 0.137 12/04/2014
33 254504 UTSW Gpr180 0.165 R2566 G1 225 N 14 118139773 V62A T C missense Het probably benign 0.063 phenotype 12/04/2014
34 254515 UTSW H2-M11 0.055 R2566 G1 225 N 17 36548150 T194I C T missense Het possibly damaging 0.758 0.052 12/04/2014
35 254470 UTSW Jakmip3 0.105 R2566 G1 173 N 7 138989468 E27V A T missense Het possibly damaging 0.885 12/04/2014
36 254507 UTSW Kcnq3 0.123 R2566 G1 225 N 15 66031427 T145A T C missense Het probably damaging 0.999 phenotype 12/04/2014
37 254510 UTSW Krt8 1.000 R2566 G1 162 N 15 101998024 M350T A G missense Het probably benign 0.029 phenotype 12/04/2014
38 254490 UTSW Krtap4-9 0.081 R2566 G1 225 N 11 99785666 T A unclassified Het probably benign 12/04/2014
39 254436 UTSW Lbr 0.829 R2566 G1 225 N 1 181836127 D109E G T missense Het probably damaging 0.964 phenotype 12/04/2014
40 254483 UTSW Med23 1.000 R2566 G1 225 N 10 24888575 H42R A G missense Het probably damaging 1.000 phenotype 12/04/2014
41 254433 UTSW Mgat5 0.000 R2566 G1 225 N 1 127307004 M77L A T missense Het probably benign 0.011 phenotype 12/04/2014
42 254445 UTSW Mlf1 0.359 R2566 G1 225 N 3 67384586 N28I A T missense Het possibly damaging 0.565 phenotype 12/04/2014
43 254434 UTSW Mroh3 0.056 R2566 G1 225 N 1 136198126 L343R A C missense Het probably damaging 0.999 12/04/2014
44 254451 UTSW Mrpl37 0.939 R2566 G1 225 N 4 107064493 I180F T A missense Het possibly damaging 0.955 phenotype 12/04/2014
45 254497 UTSW Mrps27 0.914 R2566 G1 225 N 13 99400328 C116* T A nonsense Het probably null phenotype 12/04/2014
46 254471 UTSW Muc6 0.114 R2566 G1 225 N 7 141640384 S1354P A G missense Het possibly damaging 0.734 phenotype 12/04/2014
47 254501 UTSW Myh7 0.790 R2566 G1 180 N 14 54983242 D1033E A T missense Het probably damaging 1.000 phenotype 12/04/2014
48 254472 UTSW Myo16 0.428 R2566 G1 225 N 8 10594820 E1717D A T missense Het probably benign 0.427 phenotype 12/04/2014
49 254487 UTSW Myo1g 0.000 R2566 G1 225 N 11 6512539 T A critical splice acceptor site Het probably null phenotype 12/04/2014
50 254468 UTSW Olfr610 0.065 R2566 G1 225 N 7 103506160 M262T A G missense Het probably benign 0.084 phenotype 12/04/2014
51 254486 UTSW Olfr815 0.050 R2566 G1 225 N 10 129902095 L205R A C missense Het probably damaging 1.000 phenotype 12/04/2014
52 254484 UTSW Pan2 1.000 R2566 G1 225 N 10 128313897 L576P T C missense Het probably damaging 1.000 phenotype 12/04/2014
53 254498 UTSW Parp8 0.000 R2566 G1 225 N 13 116895687 S278P A G missense Het possibly damaging 0.781 12/04/2014
54 254489 UTSW Pdk2 0.000 R2566 G1 225 N 11 95027202 A G unclassified 1115 bp Het probably null phenotype 12/04/2014
55 254513 UTSW Phf1 0.000 R2566 G1 225 N 17 26937088 S450P T C missense Het probably damaging 0.998 phenotype 12/04/2014
56 254474 UTSW Pkd1l2 0.000 R2566 G1 215 N 8 117019494 Y1919C T C missense Het probably damaging 1.000 phenotype 12/04/2014
57 254444 UTSW Postn 0.000 R2566 G1 225 N 3 54376953 S614T T A missense Het probably damaging 0.974 phenotype 12/04/2014
58 254512 UTSW Psmg1 1.000 R2566 G1 225 N 16 95982195 Y213* A T nonsense Het probably null phenotype 12/04/2014
59 254514 UTSW Rab11b 0.000 R2566 G1 192 N 17 33747718 T203S T A missense Het probably benign 0.013 phenotype 12/04/2014
60 254477 UTSW Rad54l2 1.000 R2566 G1 225 N 9 106703626 T899S T A missense Het possibly damaging 0.955 phenotype 12/04/2014
61 254491 UTSW Ramp2 1.000 R2566 G1 123 N 11 101246545 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG unclassified Het probably benign phenotype 12/04/2014
62 476639 UTSW Rapgef6 0.000 R2566 G1 225 N 11 54687711 T1028A A G missense Het possibly damaging 0.659 phenotype 05/11/2017
63 254478 UTSW Rbm6 0.896 R2566 G1 225 N 9 107791998 S58P A G missense Het possibly damaging 0.597 12/04/2014
64 254494 UTSW Rreb1 0.953 R2566 G1 225 N 13 37929792 A376S G T missense Het possibly damaging 0.623 phenotype 12/04/2014
65 254454 UTSW Rsbn1l 0.127 R2566 G1 225 N 5 20919769 N345I T A missense Het probably benign 0.403 12/04/2014
66 254516 UTSW Sf3b2 0.960 R2566 G1 225 N 19 5275090 S785T A T missense Het possibly damaging 0.921 phenotype 12/04/2014
67 254469 UTSW Sh2b1 0.348 R2566 G1 225 N 7 126468926 D519N C T missense Het probably damaging 0.994 phenotype 12/04/2014
68 254503 UTSW Slitrk6 0.210 R2566 G1 225 N 14 110750272 T668A T C missense Het probably benign 0.004 phenotype 12/04/2014
69 254440 UTSW Stkld1 0.077 R2566 G1 225 N 2 26950638 I444N T A missense Het probably damaging 1.000 12/04/2014
70 254502 UTSW Sucla2 0.881 R2566 G1 103 N 14 73552804 A T intron Het probably benign phenotype 12/04/2014
71 254447 UTSW Tmem67 1.000 R2566 G1 225 N 4 12079918 L190F T A missense Het probably damaging 0.994 phenotype 12/04/2014
72 254511 UTSW Tns2 0.000 R2566 G1 225 N 15 102108934 R281C C T missense Het probably damaging 1.000 0.344 phenotype 12/04/2014
73 476645 UTSW Trem2 0.058 R2566 G1 225 N 17 48351835 W191* G A nonsense Het probably null phenotype 05/11/2017
74 254506 UTSW Ube2d4 R2566 G1 225 N 15 58846679 A T exon Het noncoding transcript 12/04/2014
75 254496 UTSW Uimc1 0.349 R2566 G1 225 N 13 55075804 D218E G T missense Het probably damaging 0.999 phenotype 12/04/2014
76 254466 UTSW Wdr62 0.000 R2566 G1 225 N 7 30273999 V95E A T missense Het probably damaging 1.000 phenotype 12/04/2014
77 254442 UTSW Zfhx4 0.812 R2566 G1 225 N 3 5245143 V862A T C missense Het probably damaging 0.976 12/04/2014
78 254449 UTSW Zfp462 0.367 R2566 G1 225 N 4 55008522 S163T T A missense Het probably benign 0.001 phenotype 12/04/2014
79 254443 UTSW Zfp704 0.000 R2566 G1 112 N 3 9609493 D76G T C missense Het unknown phenotype 12/04/2014
[records 1 to 79 of 79]