Incidental Mutations

64 incidental mutations are currently displayed, and affect 63 genes.
9 are Possibly Damaging.
22 are Probably Damaging.
25 are Probably Benign.
8 are Probably Null.
5 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 64 of 64] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 254656 UTSW 2410089E03Rik 1.000 R2568 G1 225 N 15 8201269 V1010A T C missense Het possibly damaging 0.704 phenotype 12/04/2014
2 254661 UTSW 4930563D23Rik 0.058 R2568 G1 225 N 16 92321319 L27P A G missense Het probably damaging 1.000 12/04/2014
3 476665 UTSW A730071L15Rik 0.032 R2568 G1 162 N 11 6200161 A T utr 5 prime Het probably benign 05/11/2017
4 254642 UTSW Abca13 0.000 R2568 G1 225 N 11 9333310 N3244I A T missense Het probably benign 0.403 phenotype 12/04/2014
5 254662 UTSW Adgrf5 0.000 R2568 G1 225 N 17 43437671 T219A A G missense Het probably damaging 1.000 phenotype 12/04/2014
6 254632 UTSW Adgrg5 0.000 R2568 G1 225 N 8 94934021 N92I A T missense Het probably damaging 0.993 phenotype 12/04/2014
7 254634 UTSW Agt 0.106 R2568 G1 219 N 8 124556955 V475G A C missense Het probably damaging 1.000 phenotype 12/04/2014
8 254649 UTSW Akap6 0.671 R2568 G1 225 N 12 52887278 K518E A G missense Het possibly damaging 0.775 phenotype 12/04/2014
9 254646 UTSW Apoh 0.263 R2568 G1 225 N 11 108404871 D133E T G missense Het probably benign 0.001 phenotype 12/04/2014
10 254601 UTSW Axdnd1 0.127 R2568 G1 225 N 1 156392749 M234L T A missense Het possibly damaging 0.903 phenotype 12/04/2014
11 254655 UTSW Cacna1d 0.661 R2568 G1 225 N 14 30082511 I1335T A G missense Het probably damaging 0.989 phenotype 12/04/2014
12 254633 UTSW Cdh15 0.000 R2568 G1 225 N 8 122862024 R279Q G A missense Het probably damaging 0.998 0.647 phenotype 12/04/2014
13 254615 UTSW Cfap206 0.258 R2568 G1 225 N 4 34711566 K444* T A nonsense Het probably null 12/04/2014
14 254641 UTSW Clasp2 0.000 R2568 G1 225 N 9 113878764 I614M A G missense Het probably benign 0.000 phenotype 12/04/2014
15 254639 UTSW Col6a4 0.000 R2568 G1 225 N 9 106063076 D1218E A T missense Het possibly damaging 0.897 12/04/2014
16 254658 UTSW Csmd3 0.000 R2568 G1 207 N 15 47741236 CCTTTGCGCTT CCTT frame shift Het probably null 0.976 12/04/2014
17 254651 UTSW D130043K22Rik 0.000 R2568 G1 225 N 13 24883891 T870M C T missense Het probably damaging 0.974 phenotype 12/04/2014
18 254666 UTSW Dagla 0.000 R2568 G1 225 N 19 10248152 A883S C A missense Het probably benign 0.000 phenotype 12/04/2014
19 254640 UTSW Dhx30 1.000 R2568 G1 225 N 9 110097195 V87A A G missense Het probably damaging 0.986 phenotype 12/04/2014
20 254620 UTSW Dtx1 0.000 R2568 G1 225 N 5 120710184 V44L C A missense Het possibly damaging 0.837 phenotype 12/04/2014
21 254653 UTSW Ecm2 0.161 R2568 G1 225 N 13 49530129 S528T T A missense Het possibly damaging 0.805 phenotype 12/04/2014
22 254611 UTSW Egfem1 0.000 R2568 G1 225 N 3 29582931 N172I A T missense Het probably damaging 1.000 12/04/2014
23 254613 UTSW Fam102b 0.203 R2568 G1 225 N 3 108978848 N356I T A missense Het probably benign 0.093 12/04/2014
24 254623 UTSW Fam13a 0.000 R2568 G1 225 N 6 58935609 R686S T G missense Het probably damaging 0.999 12/04/2014
25 254602 UTSW Fmo1 0.071 R2568 G1 225 N 1 162836259 I234L T A missense Het probably benign 0.002 phenotype 12/04/2014
26 254625 UTSW Foxj2 0.594 R2568 G1 225 N 6 122828372 R68W C T missense Het probably damaging 0.995 12/04/2014
27 254617 UTSW Foxo6 0.269 R2568 G1 139 N 4 120268764 M278K A T missense Het probably benign 0.108 phenotype 12/04/2014
28 254605 UTSW Fsip2 0.127 R2568 G1 225 N 2 82990431 S5503G A G missense Het probably benign 0.144 phenotype 12/04/2014
29 254610 UTSW Gdf5 0.464 R2568 G1 84 N 2 155942090 R100G C G missense Het probably benign 0.060 phenotype 12/04/2014
30 254608 UTSW Il1b 0.145 R2568 G1 225 N 2 129367322 D129E A T missense Het probably damaging 1.000 phenotype 12/04/2014
31 254648 UTSW Klhl29 0.121 R2568 G1 225 N 12 5091350 S545P A G missense Het probably damaging 0.960 12/04/2014
32 254659 UTSW Krt83 0.069 R2568 G1 225 N 15 101487827 R296S G T missense Het possibly damaging 0.672 12/04/2014
33 254644 UTSW Llgl1 1.000 R2568 G1 225 N 11 60708812 S509R T G missense Het probably damaging 1.000 phenotype 12/04/2014
34 254600 UTSW Lmod1 0.078 R2568 G1 225 N 1 135363964 K186* A T nonsense Het probably null phenotype 12/04/2014
35 254663 UTSW Lrpprc 1.000 R2568 G1 225 N 17 84726649 A973T C T missense Het probably damaging 1.000 phenotype 12/04/2014
36 254598 UTSW Marco 0.070 R2568 G1 225 N 1 120494785 H49R T C missense Het possibly damaging 0.861 phenotype 12/04/2014
37 254652 UTSW Mylk4 0.000 R2568 G1 225 N 13 32722018 N394S T C missense Het probably null 0.972 12/04/2014
38 254637 UTSW Myo5a 0.949 R2568 G1 225 N 9 75123040 Y147C A G missense Het probably damaging 1.000 phenotype 12/04/2014
39 254638 UTSW Myo5a 0.949 R2568 G1 225 N 9 75151897 V469A T C missense Het probably damaging 1.000 phenotype 12/04/2014
40 254664 UTSW Myot 0.000 R2568 G1 225 N 18 44337216 T87A A G missense Het probably benign 0.018 phenotype 12/04/2014
41 254629 UTSW Nav2 0.831 R2568 G1 225 N 7 49597564 H2154R A G missense Het probably damaging 1.000 phenotype 12/04/2014
42 254654 UTSW Nek10 0.000 R2568 G1 225 N 14 14999112 E1037G A G missense Het possibly damaging 0.892 12/04/2014
43 254660 UTSW Olfr181 0.085 R2568 G1 225 N 16 58925923 V216A A G missense Het probably benign 0.273 phenotype 12/04/2014
44 254603 UTSW Olfr341 0.063 R2568 G1 225 N 2 36479974 D52G T C missense Het probably damaging 0.999 phenotype 12/04/2014
45 254630 UTSW Olfr677 0.100 R2568 G1 225 N 7 105056671 T142A A G missense Het probably benign 0.004 phenotype 12/04/2014
46 254650 UTSW Pitrm1 1.000 R2568 G1 225 N 13 6575092 V869F G T missense Het probably benign 0.146 phenotype 12/04/2014
47 254597 UTSW Plekhm3 0.136 R2568 G1 106 N 1 64937781 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC small deletion Het probably benign 12/04/2014
48 254616 UTSW Prdx1 0.653 R2568 G1 225 N 4 116693800 I156S T G missense Het probably benign 0.001 phenotype 12/04/2014
49 254619 UTSW Rbks 0.398 R2568 G1 225 N 5 31665752 T107S T A missense Het probably damaging 0.992 phenotype 12/04/2014
50 254607 UTSW Ryr3 0.397 R2568 G1 225 N 2 112675874 R3468W G A missense Het probably damaging 0.999 phenotype 12/04/2014
51 254604 UTSW Scn1a 1.000 R2568 G1 225 N 2 66273469 D1805N C T missense Het probably damaging 1.000 phenotype 12/04/2014
52 254609 UTSW Sirpa 0.000 R2568 G1 225 N 2 129615648 V214A T C missense Het probably benign 0.021 phenotype 12/04/2014
53 254606 UTSW Slc35c1 0.443 R2568 G1 225 N 2 92458880 N94D T C missense Het probably benign 0.001 phenotype 12/04/2014
54 254631 UTSW Sorbs2 0.000 R2568 G1 225 N 8 45795370 K553* A T nonsense Het probably null phenotype 12/04/2014
55 254667 UTSW Tectb 0.074 R2568 G1 201 N 19 55180999 C G start gained Het probably benign 0.090 phenotype 12/04/2014
56 254643 UTSW Thg1l 1.000 R2568 G1 225 N 11 45951565 V142A A G missense Het probably benign 0.000 phenotype 12/04/2014
57 254612 UTSW Tiparp 0.808 R2568 G1 225 N 3 65553130 Y513* T A nonsense Het probably null phenotype 12/04/2014
58 254647 UTSW Tmc6 0.000 R2568 G1 225 N 11 117772820 V522A A G missense Het probably benign 0.076 phenotype 12/04/2014
59 266189 UTSW Trim39 0.000 R2568 G1 173 N 17 36269164 T A unclassified Het probably benign phenotype 02/05/2015
60 254622 UTSW Trrap 1.000 R2568 G1 219 N 5 144843369 G A critical splice donor site 1 bp Het probably null phenotype 12/04/2014
61 254627 UTSW Tulp3 1.000 R2568 G1 225 N 6 128327638 V218I C T missense Het probably benign 0.004 phenotype 12/04/2014
62 254624 UTSW Vmn1r38 0.237 R2568 G1 225 N 6 66776971 I54F T A missense Het probably benign 0.003 12/04/2014
63 254626 UTSW Vmn2r23 0.076 R2568 G1 225 N 6 123742188 Y833* T A nonsense Het probably null 12/04/2014
64 254635 UTSW Zfp810 0.089 R2568 G1 225 N 9 22279238 S125T A T missense Het probably benign 0.015 12/04/2014
[records 1 to 64 of 64]