Incidental Mutations

41 incidental mutations are currently displayed, and affect 41 genes.
1 are Possibly Damaging.
17 are Probably Damaging.
16 are Probably Benign.
6 are Probably Null.
2 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 41 of 41] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 251424 UTSW Abcb1a 0.130 R2844 G1 225 Y 5 8686164 I186F A T missense Het probably benign 0.018 0.074 phenotype 12/04/2014
2 251434 UTSW Afg3l1 0.089 R2844 G1 225 Y 8 123494939 T C intron Het probably benign 0.063 phenotype 12/04/2014
3 251485 UTSW Atg4a 0.244 R2844 G1 222 Y X 140992840 E106K G A missense Het probably benign 0.000 0.078 phenotype 12/04/2014
4 251412 UTSW C130079G13Rik 0.063 R2844 G1 225 Y 3 59936409 V175I G A missense Het probably benign 0.054 0.006 12/04/2014
5 251471 UTSW Ccdc50 0.000 R2844 G1 225 Y 16 27406729 E64G A G missense Het probably damaging 1.000 0.412 12/04/2014
6 251436 UTSW Celsr3 1.000 R2844 G1 225 Y 9 108829308 G997W G T missense Het probably damaging 1.000 0.306 phenotype 12/04/2014
7 251457 UTSW Chd8 1.000 R2844 G1 225 Y 14 52204495 E2138K C T missense Het possibly damaging 0.921 0.110 phenotype 12/04/2014
8 251402 UTSW Col19a1 1.000 R2844 G1 225 Y 1 24559681 G77E C T missense Het unknown 0.302 phenotype 12/04/2014
9 251420 UTSW Fhad1 0.078 R2844 G1 195 Y 4 141904968 Q1287K G T missense Het probably benign 0.060 0.070 12/04/2014
10 251442 UTSW Fzr1 1.000 R2844 G1 225 Y 10 81369418 T159K G T missense Het probably damaging 1.000 0.298 phenotype 12/04/2014
11 251438 UTSW Gm10608 0.082 R2844 G1 150 Y 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA frame shift Het probably null 0.661 12/04/2014
12 251448 UTSW Gna13 1.000 R2844 G1 225 Y 11 109363125 I51T T C missense Het probably damaging 0.998 0.254 phenotype 12/04/2014
13 251406 UTSW Gorab 0.271 R2844 G1 225 Y 1 163396806 A G splice site 6 bp Het probably null 0.609 phenotype 12/04/2014
14 476714 UTSW Hydin 0.741 R2844 G1 225 N 8 110519114 V2153A T C missense Het probably benign 0.000 phenotype 05/15/2017
15 251459 UTSW Ints6 1.000 R2844 G1 225 Y 14 62704826 V486A A G missense Het probably damaging 0.971 0.166 phenotype 12/04/2014
16 251453 UTSW Irx2 0.792 R2844 G1 110 Y 13 72631590 K331R A G missense Het probably damaging 0.998 0.304 phenotype 12/04/2014
17 251465 UTSW Lrrc6 0.131 R2844 G1 225 Y 15 66447676 A G splice site Het probably benign 0.158 phenotype 12/04/2014
18 251479 UTSW Mark2 0.911 R2844 G1 225 Y 19 7286862 E116G T C missense Het probably damaging 1.000 0.538 phenotype 12/04/2014
19 251483 UTSW Med14 0.929 R2844 G1 222 Y X 12683996 H684Q A T missense Het probably benign 0.006 0.066 phenotype 12/04/2014
20 251445 UTSW Olfr384 0.263 R2844 G1 225 Y 11 73603383 T268S A T missense Het probably benign 0.123 0.258 phenotype 12/04/2014
21 251414 UTSW Pde5a 0.326 R2844 G1 225 Y 3 122851708 L755P T C missense Het probably damaging 1.000 0.420 phenotype 12/04/2014
22 251422 UTSW Pex14 1.000 R2844 G1 225 Y 4 148963511 I203N A T missense Het probably benign 0.022 0.434 phenotype 12/04/2014
23 251469 UTSW Pi4ka 1.000 R2844 G1 225 Y 16 17350793 E691G T C missense Het probably damaging 0.968 0.352 phenotype 12/04/2014
24 251430 UTSW Plekha1 0.295 R2844 G1 225 Y 7 130908365 W280C G T missense Het probably damaging 1.000 0.554 phenotype 12/04/2014
25 251461 UTSW Pnoc 0.099 R2844 G1 225 Y 14 65404835 F160I A T missense Het probably damaging 0.999 0.258 phenotype 12/04/2014
26 251428 UTSW Ppfia3 0.727 R2844 G1 203 Y 7 45356428 R348L C A missense Het probably damaging 1.000 0.374 phenotype 12/04/2014
27 251440 UTSW Ppil6 0.100 R2844 G1 225 Y 10 41501693 A T splice site Het probably benign 12/04/2014
28 476713 UTSW Psmd13 0.935 R2844 G1 225 N 7 140897740 C A intron Het probably benign phenotype 05/15/2017
29 251444 UTSW Psme4 0.000 R2844 G1 225 Y 11 30845173 T C splice site Het probably benign phenotype 12/04/2014
30 251481 UTSW Rfx3 1.000 R2844 G1 225 Y 19 27806786 T C splice site Het probably benign phenotype 12/04/2014
31 251455 UTSW Rnase11 0.098 R2844 G1 225 Y 14 51049770 L109S A G missense Het probably damaging 0.993 0.070 12/04/2014
32 251416 UTSW Rngtt 0.963 R2844 G1 225 N 4 33368678 T404A A G missense Het probably benign 0.000 12/04/2014
33 251467 UTSW Sbf1 0.353 R2844 G1 225 Y 15 89303218 A G critical splice donor site 2 bp Het probably null 0.548 phenotype 12/04/2014
34 251473 UTSW Sema5b 0.000 R2844 G1 225 Y 16 35659931 N656S A G missense Het probably damaging 0.980 0.238 phenotype 12/04/2014
35 251475 UTSW Ssh3 0.501 R2844 G1 225 Y 19 4265296 Y338C T C missense Het probably damaging 1.000 0.756 phenotype 12/04/2014
36 251432 UTSW Tgfbr3l 0.000 R2844 G1 148 Y 8 4249280 D49G A G missense Het probably damaging 0.968 0.156 12/04/2014
37 332098 UTSW Thbs1 0.000 R2844 G1 62 Y 2 118117628 T423I C T missense Het probably benign 0.002 0.062 phenotype 08/04/2015
38 251410 UTSW Ttc17 0.610 R2844 G1 225 Y 2 94376074 Y243* A T nonsense Het probably null 0.616 12/04/2014
39 251418 UTSW Zbtb8os 0.945 R2844 G1 225 Y 4 129341516 E54D A T missense Het probably damaging 0.991 0.065 12/04/2014
40 251404 UTSW Zfp648 0.088 R2844 G1 115 Y 1 154205135 K347* A T nonsense Het probably null 0.668 12/04/2014
41 251426 UTSW Zfp84 0.000 R2844 G1 225 Y 7 29775333 T G splice site Het probably null 0.645 12/04/2014
[records 1 to 41 of 41]