Incidental Mutations

43 incidental mutations are currently displayed, and affect 43 genes.
8 are Possibly Damaging.
11 are Probably Damaging.
15 are Probably Benign.
9 are Probably Null.
2 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 43 of 43] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 261259 UTSW 2210407C18Rik 0.061 R2911 G1 225 N 11 58608426 Q189* G A nonsense Het probably null 0.976 01/23/2015
2 261268 UTSW Abcf3 0.126 R2911 G1 225 N 16 20560232 T645A A G missense Het probably damaging 0.983 0.203 01/23/2015
3 261253 UTSW Adam10 1.000 R2911 G1 225 N 9 70718723 S91L C T missense Het probably damaging 0.985 phenotype 01/23/2015
4 261277 UTSW Ahnak 0.272 R2911 G1 225 N 19 9011654 D3434G A G missense Het probably damaging 0.994 0.209 phenotype 01/23/2015
5 261250 UTSW Ankrd11 1.000 R2911 G1 225 N 8 122908798 D32E A T missense Het probably damaging 0.995 0.075 phenotype 01/23/2015
6 261228 UTSW Cacna1b 0.000 R2911 G1 225 N 2 24607541 A T unclassified Het probably null phenotype 01/23/2015
7 261254 UTSW Cd109 0.000 R2911 G1 201 N 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 01/23/2015
8 261240 UTSW Cep104 0.168 R2911 G1 118 N 4 153995427 T A splice site Het probably null 0.976 phenotype 01/23/2015
9 261255 UTSW Clstn2 0.000 R2911 G1 214 N 9 97532722 V373A A G missense Het probably damaging 0.995 phenotype 01/23/2015
10 261280 UTSW Cyp2c65 0.080 R2911 G1 223 N 19 39087682 I359M T G missense Het probably damaging 0.959 01/23/2015
11 261237 UTSW Cyp4a12b 0.065 R2911 G1 209 N 4 115433526 K282* A T nonsense Het probably null 01/23/2015
12 261262 UTSW Ddx1 1.000 R2911 G1 225 N 12 13231440 C T splice site 5 bp Het probably null 0.976 phenotype 01/23/2015
13 261222 UTSW Dnah7a 0.129 R2911 G1 225 N 1 53427824 A T critical splice donor site 2 bp Het probably null 01/23/2015
14 261256 UTSW Dzip1l 0.219 R2911 G1 225 N 9 99655602 V419A T C missense Het probably benign 0.004 01/23/2015
15 261270 UTSW Epha3 0.416 R2911 G1 225 N 16 63652412 V370G A C missense Het probably benign 0.000 phenotype 01/23/2015
16 261276 UTSW Fbxo38 0.000 R2911 G1 225 N 18 62519807 D523G T C missense Het probably benign 0.008 0.090 01/23/2015
17 261243 UTSW Fryl 0.849 R2911 G1 225 N 5 73050456 D2457G T C missense Het probably damaging 0.993 phenotype 01/23/2015
18 261281 UTSW Gm379 0.171 R2911 G1 222 N X 108664765 F43V A C missense Het possibly damaging 0.813 0.179 01/23/2015
19 261238 UTSW Grhl3 0.937 R2911 G1 225 N 4 135559146 I75V T C missense Het probably benign 0.003 0.065 phenotype 01/23/2015
20 261257 UTSW Lcp2 1.000 R2911 G1 225 N 11 34068970 G A unclassified 1 bp Het probably null 0.950 phenotype 01/23/2015
21 261279 UTSW Lipo3 0.080 R2911 G1 225 N 19 33579367 I220F T A missense Het probably benign 0.001 01/23/2015
22 261229 UTSW Lrp1b 0.000 R2911 G1 225 N 2 41506692 E340G T C missense Het probably benign 0.002 phenotype 01/23/2015
23 261249 UTSW Mbtps1 1.000 R2911 G1 225 N 8 119546037 I123T A G missense Het possibly damaging 0.819 0.784 phenotype 01/23/2015
24 261272 UTSW Ndc80 0.961 R2911 G1 225 N 17 71500376 S528R A T missense Het probably benign 0.000 phenotype 01/23/2015
25 261234 UTSW Odf2l 0.249 R2911 G1 225 N 3 145124323 I19L A C missense Het probably benign 0.002 0.090 01/23/2015
26 261269 UTSW Olfr193 0.077 R2911 G1 225 N 16 59110181 R143H C T missense Het probably benign 0.002 0.090 phenotype 01/23/2015
27 261251 UTSW Olfr873 0.111 R2911 G1 225 N 9 20300479 K94R A G missense Het possibly damaging 0.599 phenotype 01/23/2015
28 261252 UTSW Olfr958 0.086 R2911 G1 225 N 9 39550821 I17V T C missense Het possibly damaging 0.757 phenotype 01/23/2015
29 261223 UTSW Pigr 0.072 R2911 G1 225 N 1 130849533 D692G A G missense Het probably damaging 0.999 0.429 phenotype 01/23/2015
30 261273 UTSW Reep2 0.189 R2911 G1 217 N 18 34845690 T C critical splice donor site 2 bp Het probably null 0.950 phenotype 01/23/2015
31 261263 UTSW Rin3 0.000 R2911 G1 225 N 12 102373584 S598A T G missense Het probably benign 0.432 phenotype 01/23/2015
32 261264 UTSW Rreb1 0.946 R2911 G1 225 N 13 37948920 E1690D A T missense Het probably benign 0.001 phenotype 01/23/2015
33 261266 UTSW Rubcnl 0.116 R2911 G1 225 N 14 75040808 T344I C T missense Het probably benign 0.059 0.233 01/23/2015
34 261224 UTSW Shcbp1l 0.292 R2911 G1 225 N 1 153428626 L144I C A missense Het probably damaging 0.979 0.144 phenotype 01/23/2015
35 261275 UTSW Snx2 0.000 R2911 G1 225 N 18 53199874 P207S C T missense Het probably damaging 0.989 0.668 phenotype 01/23/2015
36 261221 UTSW Sox17 1.000 R2911 G1 225 N 1 4493131 D92E A T missense Het probably damaging 0.996 phenotype 01/23/2015
37 261239 UTSW Spata21 0.082 R2911 G1 225 N 4 141103082 M288V A G missense Het possibly damaging 0.464 01/23/2015
38 261274 UTSW Sra1 0.000 R2911 G1 225 N 18 36676185 D273G T C missense Het possibly damaging 0.488 phenotype 01/23/2015
39 261278 UTSW Syt7 0.000 R2911 G1 225 N 19 10443435 I448T T C missense Het probably benign 0.003 phenotype 01/23/2015
40 261247 UTSW Tac1 0.213 R2911 G1 225 N 6 7559097 A G critical splice acceptor site Het probably null 0.949 phenotype 01/23/2015
41 261235 UTSW Tgs1 1.000 R2911 G1 225 N 4 3585616 N164K C A missense Het probably benign 0.003 phenotype 01/23/2015
42 261248 UTSW Tmem72 0.148 R2911 G1 225 N 6 116698331 I67F T A missense Het possibly damaging 0.928 phenotype 01/23/2015
43 261244 UTSW Ythdc1 0.965 R2911 G1 225 N 5 86816559 S88P T C missense Het possibly damaging 0.954 01/23/2015
[records 1 to 43 of 43]