Incidental Mutations

39 incidental mutations are currently displayed, and affect 39 genes.
2 are Possibly Damaging.
16 are Probably Damaging.
15 are Probably Benign.
6 are Probably Null.
0 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 39 of 39] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 254797 UTSW Adgrf3 0.000 R2914 G1 225 Y 5 30196994 S679P A G missense Het probably damaging 1.000 0.299 12/29/2014
2 254810 UTSW Cd109 0.000 R2914 G1 217 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.090 phenotype 12/29/2014
3 254816 UTSW Cryl1 0.108 R2914 G1 225 Y 14 57275918 E282G T C missense Het probably benign 0.192 0.090 phenotype 12/29/2014
4 254815 UTSW Dbn1 0.722 R2914 G1 225 Y 13 55482421 F45L A G missense Het probably damaging 0.966 0.768 phenotype 12/29/2014
5 254791 UTSW Dclre1b 1.000 R2914 G1 225 Y 3 103808114 M105V T C missense Het probably damaging 0.980 0.491 phenotype 12/29/2014
6 254804 UTSW Defb12 0.065 R2914 G1 225 Y 8 19114814 N3D T C missense Het probably benign 0.000 0.090 12/29/2014
7 254785 UTSW Eprs 1.000 R2914 G1 225 Y 1 185379742 G A splice site 5 bp Het probably null 0.976 phenotype 12/29/2014
8 254807 UTSW Fa2h 0.311 R2914 G1 188 Y 8 111393649 D35G T C missense Het probably damaging 1.000 0.947 phenotype 12/29/2014
9 254809 UTSW Fdxacb1 0.000 R2914 G1 225 Y 9 50768399 A39V C T missense Het probably benign 0.047 0.095 phenotype 12/29/2014
10 254800 UTSW Fras1 0.000 R2914 G1 148 Y 5 96733915 R2502K G A missense Het probably benign 0.000 0.075 phenotype 12/29/2014
11 254812 UTSW Grm1 0.138 R2914 G1 225 Y 10 11079857 S228P A G missense Het probably benign 0.072 0.906 phenotype 12/29/2014
12 254806 UTSW Il27ra 0.066 R2914 G1 225 Y 8 84031613 T A unclassified Het probably benign 0.090 phenotype 12/29/2014
13 254802 UTSW Lrrtm1 0.000 R2914 G1 225 Y 6 77244979 Q473L A T missense Het probably damaging 0.994 0.089 phenotype 12/29/2014
14 254796 UTSW Macf1 1.000 R2914 G1 225 Y 4 123475911 I121F T A missense Het probably damaging 0.999 0.216 phenotype 12/29/2014
15 254784 UTSW Mael 0.292 R2914 G1 225 Y 1 166226610 F188I A T missense Het probably damaging 1.000 0.447 phenotype 12/29/2014
16 254822 UTSW Mapk4 0.000 R2914 G1 225 Y 18 73935165 A232T C T missense Het probably benign 0.343 0.079 phenotype 12/29/2014
17 254789 UTSW Mrpl9 0.949 R2914 G1 225 Y 3 94443801 T96K C A missense Het probably damaging 0.991 0.232 phenotype 12/29/2014
18 254793 UTSW Musk 1.000 R2914 G1 225 Y 4 58366938 L511I C A missense Het probably damaging 0.994 0.159 phenotype 12/29/2014
19 254795 UTSW Mutyh 0.000 R2914 G1 225 Y 4 116815629 D60N G A missense Het probably damaging 0.991 0.144 phenotype 12/29/2014
20 254783 UTSW Nckap5 0.000 R2914 G1 225 Y 1 126026537 A T splice site Het probably null 0.081 12/29/2014
21 254811 UTSW Nktr 0.632 R2914 G1 225 Y 9 121749604 T C unclassified Het probably benign 0.060 phenotype 12/29/2014
22 254790 UTSW Otud7b 1.000 R2914 G1 225 Y 3 96155955 A837E C A missense Het probably benign 0.008 0.090 phenotype 12/29/2014
23 266192 UTSW Pigb 0.864 R2914 G1 99 N 9 73039778 A T splice site Het probably null phenotype 02/05/2015
24 254814 UTSW Pip4k2b 0.308 R2914 G1 225 Y 11 97722434 N245K G T missense Het probably benign 0.044 0.090 phenotype 12/29/2014
25 254794 UTSW Ptprd 0.000 R2914 G1 225 Y 4 75947101 D1464V T A missense Het probably damaging 1.000 0.971 phenotype 12/29/2014
26 254788 UTSW Rab22a 0.000 R2914 G1 225 Y 2 173695281 N98S A G missense Het probably benign 0.005 0.060 phenotype 12/29/2014
27 254817 UTSW Rictor 1.000 R2914 G1 225 Y 15 6769995 G T critical splice donor site 1 bp Het probably null 0.948 phenotype 12/29/2014
28 254782 UTSW Rims1 0.466 R2914 G1 225 Y 1 22805630 E32G T C missense Het probably damaging 1.000 0.166 phenotype 12/29/2014
29 254787 UTSW Slx4ip 0.000 R2914 G1 225 Y 2 137067591 A G critical splice acceptor site Het probably null 0.949 12/29/2014
30 254808 UTSW Snx19 0.110 R2914 G1 225 Y 9 30433532 G A unclassified Het probably benign phenotype 12/29/2014
31 254819 UTSW Snx29 0.000 R2914 G1 225 Y 16 11447453 R516W C T missense Het probably damaging 0.992 0.647 12/29/2014
32 254821 UTSW Tcof1 1.000 R2914 G1 225 Y 18 60816084 D1253G T C missense Het possibly damaging 0.845 0.179 phenotype 12/29/2014
33 254792 UTSW Tmod1 1.000 R2914 G1 225 Y 4 46092259 N203I A T missense Het probably damaging 0.999 0.958 phenotype 12/29/2014
34 254820 UTSW Tmprss15 0.000 R2914 G1 225 Y 16 78962190 N880S T C missense Het probably benign 0.452 0.108 phenotype 12/29/2014
35 254786 UTSW Ttn 1.000 R2914 G1 225 Y 2 76769635 I19065N A T missense Het probably damaging 0.999 0.275 phenotype 12/29/2014
36 254799 UTSW Txk 0.000 R2914 G1 225 Y 5 72724451 N154S T C missense Het probably damaging 0.999 0.107 phenotype 12/29/2014
37 254813 UTSW Utp20 0.950 R2914 G1 225 Y 10 88754475 A G critical splice donor site 2 bp Het probably null phenotype 12/29/2014
38 254803 UTSW Vmn1r65 0.055 R2914 G1 225 Y 7 6009041 I65F T A missense Het possibly damaging 0.690 0.179 12/29/2014
39 254798 UTSW Yes1 0.778 R2914 G1 225 Y 5 32640582 S82P T C missense Het probably benign 0.000 0.057 phenotype 12/29/2014
[records 1 to 39 of 39]