Incidental Mutations

12 incidental mutations are currently displayed, and affect 12 genes.
0 are Possibly Damaging.
5 are Probably Damaging.
6 are Probably Benign.
1 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 12 of 12] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 257172 UTSW 4931406B18Rik 0.066 R2995 G1 225 N 7 43499368 C43R A G missense Het probably damaging 0.998 01/11/2015
2 257178 UTSW Arsi 0.078 R2995 G1 225 N 18 60916651 G202E G A missense Het probably benign 0.068 0.063 phenotype 01/11/2015
3 257174 UTSW Clpb 0.863 R2995 G1 225 N 7 101779324 H430Q T A missense Het probably damaging 1.000 phenotype 01/11/2015
4 257168 UTSW Eloa 1.000 R2995 G1 225 N 4 136010906 H248N G T missense Het probably benign 0.011 phenotype 01/11/2015
5 257165 UTSW Gpsm1 0.000 R2995 G1 225 N 2 26319831 G A unclassified Het probably benign phenotype 01/11/2015
6 257176 UTSW Lhfpl2 0.142 R2995 G1 225 N 13 94174458 T79A A G missense Het probably benign 0.035 phenotype 01/11/2015
7 257167 UTSW Prkaa2 0.000 R2995 G1 143 N 4 105052007 Y80C T C missense Het probably damaging 0.998 phenotype 01/11/2015
8 257164 UTSW Slc4a3 0.115 R2995 G1 225 N 1 75552662 C541* T A nonsense Het probably null phenotype 01/11/2015
9 257169 UTSW Slc4a4 1.000 R2995 G1 225 N 5 88934814 E22V A T missense Het probably damaging 0.999 phenotype 01/11/2015
10 257173 UTSW Stard5 0.000 R2995 G1 225 N 7 83632743 V36A T C missense Het probably damaging 0.997 phenotype 01/11/2015
11 257166 UTSW Tchh 0.068 R2995 G1 180 N 3 93447750 CACGCGAGGAACGCGAGGAAC CACGCGAGGAAC small deletion Het probably benign 01/11/2015
12 257175 UTSW Trpc6 0.000 R2995 G1 148 N 9 8544466 G12V G T missense Het probably benign 0.296 phenotype 01/11/2015
[records 1 to 12 of 12]