Incidental Mutations

23 incidental mutations are currently displayed, and affect 23 genes.
3 are Possibly Damaging.
10 are Probably Damaging.
10 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 23 of 23] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 265786 UTSW Arhgef37 0.195 R3024 G1 225 N 18 61501888 E461G T C missense Het probably damaging 0.963 02/05/2015
2 265768 UTSW Bfsp1 0.219 R3024 G1 225 N 2 143845959 V182D A T missense Het probably benign 0.191 phenotype 02/05/2015
3 265784 UTSW Birc6 1.000 R3024 G1 225 N 17 74608219 S1635P T C missense Het possibly damaging 0.834 phenotype 02/05/2015
4 265771 UTSW Chil6 0.057 R3024 G1 225 N 3 106388770 D383G T C missense Het probably damaging 1.000 02/05/2015
5 265774 UTSW Itpr2 0.000 R3024 G1 225 N 6 146180310 A175V G A missense Het probably benign 0.347 phenotype 02/05/2015
6 265766 UTSW Kcnh7 0.121 R3024 G1 225 N 2 62764663 R688S G T missense Het probably damaging 0.999 phenotype 02/05/2015
7 265782 UTSW Krt6a 0.226 R3024 G1 225 N 15 101691289 C463S A T missense Het probably benign 0.020 phenotype 02/05/2015
8 265773 UTSW Ksr2 0.116 R3024 G1 225 N 5 117555060 I191N T A missense Het possibly damaging 0.524 phenotype 02/05/2015
9 265779 UTSW Lyst 0.251 R3024 G1 225 N 13 13658687 V1698A T C missense Het probably benign 0.000 phenotype 02/05/2015
10 265783 UTSW Olfr103 0.070 R3024 G1 225 N 17 37337027 D68E A T missense Het probably damaging 1.000 phenotype 02/05/2015
11 265767 UTSW Olfr1262 0.075 R3024 G1 225 N 2 90003240 N278I A T missense Het probably damaging 1.000 phenotype 02/05/2015
12 265765 UTSW Pappa2 0.000 R3024 G1 225 N 1 158936225 R572Q C T missense Het probably benign 0.001 phenotype 02/05/2015
13 265777 UTSW Pes1 1.000 R3024 G1 120 N 11 3977719 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 02/05/2015
14 265769 UTSW Phf20 0.845 R3024 G1 225 N 2 156287867 H453R A G missense Het probably damaging 0.961 phenotype 02/05/2015
15 265770 UTSW Prex1 0.280 R3024 G1 225 N 2 166589036 H615Q G T missense Het probably benign 0.044 phenotype 02/05/2015
16 265772 UTSW Slc25a54 0.297 R3024 G1 225 N 3 109080666 I41N T A missense Het probably damaging 0.999 02/05/2015
17 265764 UTSW Slc35f5 0.358 R3024 G1 225 N 1 125568598 S157G A G missense Het probably benign 0.005 02/05/2015
18 265781 UTSW Sstr3 0.000 R3024 G1 203 N 15 78539987 R187W G A missense Het probably damaging 0.991 phenotype 02/05/2015
19 265778 UTSW Trim41 0.264 R3024 G1 225 N 11 48808158 K420E T C missense Het possibly damaging 0.479 phenotype 02/05/2015
20 265776 UTSW Tsnaxip1 0.605 R3024 G1 225 N 8 105841743 Y353C A G missense Het probably damaging 0.996 02/05/2015
21 265785 UTSW Vmn1r238 0.078 R3024 G1 225 N 18 3123305 I36M T C missense Het probably benign 0.126 02/05/2015
22 265775 UTSW Xylt1 0.136 R3024 G1 225 N 7 117548648 V149D T A missense Het probably damaging 1.000 phenotype 02/05/2015
23 265780 UTSW Zfpm2 1.000 R3024 G1 225 N 15 41102959 E815K G A missense Het probably benign 0.004 phenotype 02/05/2015
[records 1 to 23 of 23]