Incidental Mutations

23 incidental mutations are currently displayed, and affect 23 genes.
3 are Possibly Damaging.
10 are Probably Damaging.
10 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 23 of 23] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 265786 UTSW Arhgef37 0.164 R3024 G1 225 N 18 61501888 E461G T C missense Het probably damaging 0.963 02/05/2015
2 265768 UTSW Bfsp1 0.205 R3024 G1 225 N 2 143845959 V182D A T missense Het probably benign 0.191 phenotype 02/05/2015
3 265784 UTSW Birc6 1.000 R3024 G1 225 N 17 74608219 S1635P T C missense Het possibly damaging 0.834 phenotype 02/05/2015
4 265771 UTSW Chil6 0.055 R3024 G1 225 N 3 106388770 D383G T C missense Het probably damaging 1.000 02/05/2015
5 265774 UTSW Itpr2 0.000 R3024 G1 225 N 6 146180310 A175V G A missense Het probably benign 0.347 phenotype 02/05/2015
6 265766 UTSW Kcnh7 0.097 R3024 G1 225 N 2 62764663 R688S G T missense Het probably damaging 0.999 phenotype 02/05/2015
7 265782 UTSW Krt6a 0.203 R3024 G1 225 N 15 101691289 C463S A T missense Het probably benign 0.020 phenotype 02/05/2015
8 265773 UTSW Ksr2 0.123 R3024 G1 225 N 5 117555060 I191N T A missense Het possibly damaging 0.524 phenotype 02/05/2015
9 265779 UTSW Lyst 0.269 R3024 G1 225 N 13 13658687 V1698A T C missense Het probably benign 0.000 phenotype 02/05/2015
10 265783 UTSW Olfr103 0.054 R3024 G1 225 N 17 37337027 D68E A T missense Het probably damaging 1.000 phenotype 02/05/2015
11 265767 UTSW Olfr1262 0.063 R3024 G1 225 N 2 90003240 N278I A T missense Het probably damaging 1.000 phenotype 02/05/2015
12 265765 UTSW Pappa2 0.000 R3024 G1 225 N 1 158936225 R572Q C T missense Het probably benign 0.001 phenotype 02/05/2015
13 265777 UTSW Pes1 1.000 R3024 G1 120 N 11 3977719 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 02/05/2015
14 265769 UTSW Phf20 0.906 R3024 G1 225 N 2 156287867 H453R A G missense Het probably damaging 0.961 phenotype 02/05/2015
15 265770 UTSW Prex1 0.248 R3024 G1 225 N 2 166589036 H615Q G T missense Het probably benign 0.044 phenotype 02/05/2015
16 265772 UTSW Slc25a54 0.152 R3024 G1 225 N 3 109080666 I41N T A missense Het probably damaging 0.999 02/05/2015
17 265764 UTSW Slc35f5 0.182 R3024 G1 225 N 1 125568598 S157G A G missense Het probably benign 0.005 02/05/2015
18 265781 UTSW Sstr3 0.000 R3024 G1 203 N 15 78539987 R187W G A missense Het probably damaging 0.991 phenotype 02/05/2015
19 265778 UTSW Trim41 0.358 R3024 G1 225 N 11 48808158 K420E T C missense Het possibly damaging 0.479 phenotype 02/05/2015
20 265776 UTSW Tsnaxip1 0.446 R3024 G1 225 N 8 105841743 Y353C A G missense Het probably damaging 0.996 02/05/2015
21 265785 UTSW Vmn1r238 0.060 R3024 G1 225 N 18 3123305 I36M T C missense Het probably benign 0.126 02/05/2015
22 265775 UTSW Xylt1 0.224 R3024 G1 225 N 7 117548648 V149D T A missense Het probably damaging 1.000 phenotype 02/05/2015
23 265780 UTSW Zfpm2 1.000 R3024 G1 225 N 15 41102959 E815K G A missense Het probably benign 0.004 phenotype 02/05/2015
[records 1 to 23 of 23]