Incidental Mutations

26 incidental mutations are currently displayed, and affect 26 genes.
4 are Possibly Damaging.
12 are Probably Damaging.
7 are Probably Benign.
2 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 26 of 26] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 264736 UTSW Abcc5 0.000 R3031 G1 225 N 16 20375113 V753L C A missense Het probably damaging 0.992 phenotype 02/05/2015
2 264735 UTSW Ap3b1 0.341 R3031 G1 225 N 13 94565643 L1068P T C missense Het unknown phenotype 02/05/2015
3 264739 UTSW Cacna1h 0.000 R3031 G1 174 N 17 25433134 R12L C A missense Het probably damaging 0.986 phenotype 02/05/2015
4 264719 UTSW Cbln4 0.241 R3031 G1 225 N 2 172042180 V40A A G missense Het probably damaging 0.992 phenotype 02/05/2015
5 264730 UTSW Ccdc170 0.380 R3031 G1 225 N 10 4518931 S160P T C missense Het probably damaging 0.988 phenotype 02/05/2015
6 264727 UTSW Cdc37 0.957 R3031 G1 123 N 9 21143191 E46G T C missense Het possibly damaging 0.881 phenotype 02/05/2015
7 264732 UTSW Cltc 0.958 R3031 G1 225 N 11 86730332 H287R T C missense Het probably damaging 0.999 phenotype 02/05/2015
8 264742 UTSW Dsg1a 0.114 R3031 G1 225 N 18 20340492 D874V A T missense Het probably damaging 1.000 phenotype 02/05/2015
9 264741 UTSW Gjd4 0.000 R3031 G1 225 N 18 9280811 S89* G T nonsense Het probably null 0.976 phenotype 02/05/2015
10 264721 UTSW Gkn3 0.064 R3031 G1 185 N 6 87383525 A163T C T missense Het probably damaging 1.000 0.647 02/05/2015
11 264726 UTSW Hydin 0.709 R3031 G1 225 N 8 110603216 R4861G A G missense Het possibly damaging 0.833 phenotype 02/05/2015
12 264740 UTSW Kcnh8 0.000 R3031 G1 201 N 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 02/05/2015
13 264723 UTSW Lipe 0.000 R3031 G1 225 N 7 25384895 E588G T C missense Het possibly damaging 0.650 phenotype 02/05/2015
14 264715 UTSW Mael 0.577 R3031 G1 225 N 1 166204806 D328G T C missense Het probably damaging 1.000 phenotype 02/05/2015
15 477555 UTSW Mboat7 0.689 R3031 G1 225 N 7 3678688 V398A A G missense Het probably benign 0.000 phenotype 05/15/2017
16 264725 UTSW Slc35e1 0.223 R3031 G1 225 N 8 72484891 W258R A G missense Het probably benign 0.026 02/05/2015
17 264718 UTSW Slc9a8 0.000 R3031 G1 121 N 2 167451281 D183G A G missense Het probably damaging 0.999 phenotype 02/05/2015
18 264743 UTSW Sorcs1 0.102 R3031 G1 225 N 19 50225175 R705C G A missense Het probably damaging 0.980 0.647 phenotype 02/05/2015
19 264731 UTSW Sult3a1 0.246 R3031 G1 225 N 10 33877349 D214N G A missense Het possibly damaging 0.698 02/05/2015
20 264714 UTSW Traf3ip1 1.000 R3031 G1 225 N 1 91520100 V433A T C missense Het probably damaging 0.997 phenotype 02/05/2015
21 264737 UTSW Ubxn7 1.000 R3031 G1 225 N 16 32375307 D232E T A missense Het probably benign 0.339 02/05/2015
22 264724 UTSW Upf1 0.968 R3031 G1 225 N 8 70338460 R544H C T missense Het probably damaging 1.000 0.896 phenotype 02/05/2015
23 264728 UTSW Vps13c 0.000 R3031 G1 225 N 9 67923770 S1561P T C missense Het probably benign 0.001 phenotype 02/05/2015
24 264729 UTSW Wdr48 1.000 R3031 G1 225 N 9 119924110 V593A T C missense Het probably benign 0.024 phenotype 02/05/2015
25 264733 UTSW Zfp58 0.125 R3031 G1 225 N 13 67492112 F87L A G missense Het probably benign 0.060 02/05/2015
26 264717 UTSW Zfp663 0.070 R3031 G1 225 N 2 165353696 L201* A T nonsense Het probably null 02/05/2015
[records 1 to 26 of 26]