Incidental Mutations

22 incidental mutations are currently displayed, and affect 22 genes.
4 are Possibly Damaging.
9 are Probably Damaging.
7 are Probably Benign.
2 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 22 of 22] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 263096 UTSW AW551984 0.060 R3117 G1 225 N 9 39593360 T532A T C missense Het probably benign 0.075 02/05/2015
2 263105 UTSW Dglucy 0.121 R3117 G1 169 N 12 100838678 S143G A G missense Het probably benign 0.000 phenotype 02/05/2015
3 263099 UTSW Dlec1 0.000 R3117 G1 225 N 9 119143903 G A unclassified 4120 bp Het probably null phenotype 02/05/2015
4 263106 UTSW Fcho2 1.000 R3117 G1 225 N 13 98777438 I217S A C missense Het probably damaging 0.999 02/05/2015
5 263108 UTSW Filip1l 0.000 R3117 G1 225 N 16 57506732 S42P T C missense Het probably benign 0.068 02/05/2015
6 263092 UTSW Fras1 0.000 R3117 G1 225 N 5 96771712 A3595T G A missense Het probably damaging 1.000 phenotype 02/05/2015
7 263097 UTSW Hacd3 0.145 R3117 G1 225 N 9 64998309 D182E G T missense Het probably damaging 1.000 02/05/2015
8 263087 UTSW Hsfy2 0.050 R3117 G1 225 N 1 56637106 D91H C G missense Het probably damaging 0.998 02/05/2015
9 263101 UTSW Man1a 0.702 R3117 G1 225 N 10 54030794 M295L T A missense Het probably damaging 0.966 phenotype 02/05/2015
10 263094 UTSW Mkrn3 0.000 R3117 G1 217 N 7 62419214 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA small deletion Het probably benign phenotype 02/05/2015
11 263107 UTSW Mlc1 0.000 R3117 G1 223 N 15 88976528 D93G T C missense Het probably damaging 1.000 phenotype 02/05/2015
12 263098 UTSW Myo5c 0.000 R3117 G1 225 N 9 75266194 G A critical splice donor site 1 bp Het probably null 02/05/2015
13 263112 UTSW Nlrc4 0.121 R3117 G1 225 N 17 74436068 I852V T C missense Het probably benign 0.001 phenotype 02/05/2015
14 263110 UTSW Notch3 0.000 R3117 G1 225 N 17 32158115 C272Y C T missense Het probably damaging 1.000 phenotype 02/05/2015
15 263095 UTSW Olfr855 0.196 R3117 G1 225 N 9 19584941 I135F A T missense Het probably damaging 0.993 phenotype 02/05/2015
16 263090 UTSW Ovgp1 0.000 R3117 G1 225 N 3 105986452 T C unclassified Het probably benign phenotype 02/05/2015
17 263102 UTSW Pbld2 0.000 R3117 G1 225 N 10 63054436 T208A A G missense Het probably benign 0.001 02/05/2015
18 263104 UTSW Prpf39 0.937 R3117 G1 225 N 12 65057877 V572A T C missense Het possibly damaging 0.786 02/05/2015
19 263088 UTSW Rufy4 0.243 R3117 G1 225 N 1 74147663 C537R T C missense Het probably damaging 0.988 0.860 02/05/2015
20 263109 UTSW Ttc3 0.645 R3117 G1 225 N 16 94442563 R1142Q G A missense Het possibly damaging 0.511 02/05/2015
21 263103 UTSW Ttc41 0.150 R3117 G1 225 N 10 86724320 M369T T C missense Het possibly damaging 0.621 02/05/2015
22 477740 UTSW Vwa3b 0.057 R3117 G1 225 N 1 37109077 V437I G A missense Het possibly damaging 0.955 05/15/2017
[records 1 to 22 of 22]