Incidental Mutations

38 incidental mutations are currently displayed, and affect 38 genes.
7 are Possibly Damaging.
12 are Probably Damaging.
14 are Probably Benign.
4 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 38 of 38] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 264186 UTSW Abhd16b 0.205 R3124 G1 225 Y 2 181494526 R407H G A missense Het possibly damaging 0.703 0.138 02/05/2015
2 264199 UTSW Bag4 0.190 R3124 G1 225 Y 8 25769488 A228T C T missense Het probably benign 0.000 0.090 phenotype 02/05/2015
3 264202 UTSW Cadm1 0.000 R3124 G1 225 Y 9 47799477 E226G A G missense Het possibly damaging 0.937 0.123 phenotype 02/05/2015
4 264205 UTSW Caskin2 0.266 R3124 G1 225 Y 11 115804797 D246G T C missense Het probably damaging 0.995 0.211 phenotype 02/05/2015
5 264212 UTSW Cd80 0.094 R3124 G1 225 Y 16 38473893 V46E T A missense Het probably damaging 1.000 0.872 phenotype 02/05/2015
6 264198 UTSW Ctr9 1.000 R3124 G1 225 Y 7 111053446 R984C C T missense Het unknown 0.087 phenotype 02/05/2015
7 264218 UTSW Dach2 0.000 R3124 G1 222 Y X 113819967 I417T T C missense Het possibly damaging 0.785 0.091 phenotype 02/05/2015
8 264213 UTSW Drd3 0.212 R3124 G1 140 Y 16 43822792 F464L T C missense Het probably damaging 1.000 0.576 phenotype 02/05/2015
9 264215 UTSW Dyrk1a 1.000 R3124 G1 225 Y 16 94668801 G A splice site Het probably benign 0.090 phenotype 02/05/2015
10 264185 UTSW Fam227b 0.069 R3124 G1 225 Y 2 126124086 T140A T C missense Het probably benign 0.364 0.090 phenotype 02/05/2015
11 264210 UTSW Fam91a1 0.000 R3124 G1 225 Y 15 58421889 I101V A G missense Het probably benign 0.337 0.064 phenotype 02/05/2015
12 264203 UTSW Fem1b 0.445 R3124 G1 225 Y 9 62796554 I475V T C missense Het probably benign 0.001 0.059 phenotype 02/05/2015
13 264200 UTSW Glra3 0.000 R3124 G1 225 Y 8 56125209 R434G A G missense Het possibly damaging 0.936 0.087 phenotype 02/05/2015
14 264184 UTSW Hsd17b12 1.000 R3124 G1 225 Y 2 94033958 R268Q C T missense Het probably benign 0.028 0.060 phenotype 02/05/2015
15 477975 UTSW Iglc3 0.108 R3124 G1 225 N 16 19065595 T C unclassified Het probably benign 05/15/2017
16 264182 UTSW Khdrbs2 0.227 R3124 G1 225 Y 1 32519777 R408L C A missense Het probably damaging 0.982 0.647 phenotype 02/05/2015
17 264216 UTSW Loxhd1 0.193 R3124 G1 225 Y 18 77431078 D1860G A G missense Het probably damaging 0.972 0.213 phenotype 02/05/2015
18 264209 UTSW Mcpt8 0.055 R3124 G1 225 Y 14 56083941 I22K A T missense Het probably damaging 0.984 0.647 phenotype 02/05/2015
19 264190 UTSW Myo1h 1.000 R3124 G1 225 Y 5 114328799 I303V A G missense Het probably benign 0.040 0.082 02/05/2015
20 264191 UTSW Nipsnap2 0.000 R3124 G1 225 Y 5 129748034 G A critical splice donor site 1 bp Het probably null 0.959 phenotype 02/05/2015
21 334589 UTSW Nop2 0.965 R3124 G1 225 Y 6 125132201 G A utr 5 prime Het probably benign 0.090 phenotype 09/16/2015
22 264217 UTSW Pet2 0.141 R3124 G1 222 Y X 89404721 Y601N A T missense Het probably benign 0.011 0.090 02/05/2015
23 264204 UTSW Polr2a 0.968 R3124 G1 225 Y 11 69735710 S1566T A T missense Het possibly damaging 0.922 0.179 phenotype 02/05/2015
24 264194 UTSW Pthlh 1.000 R3124 G1 224 Y 6 147263291 V27E A T missense Het probably damaging 0.983 0.342 phenotype 02/05/2015
25 264183 UTSW Ralgps1 0.220 R3124 G1 225 Y 2 33158956 T314A T C missense Het possibly damaging 0.810 0.066 phenotype 02/05/2015
26 264201 UTSW Robo4 0.210 R3124 G1 217 Y 9 37411490 CGG CG frame shift Het probably null 0.976 phenotype 02/05/2015
27 264187 UTSW Skil 0.000 R3124 G1 225 Y 3 31097338 N3S A G missense Het probably benign 0.026 0.058 phenotype 02/05/2015
28 264192 UTSW Tas2r129 0.054 R3124 G1 225 Y 6 132951448 N116S A G missense Het probably damaging 0.996 0.280 02/05/2015
29 264193 UTSW Tas2r140 0.057 R3124 G1 225 Y 6 133055241 I185L T A missense Het probably benign 0.046 0.090 phenotype 02/05/2015
30 264208 UTSW Tnpo1 0.967 R3124 G1 138 Y 13 98867129 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC frame shift Het probably null 0.976 phenotype 02/05/2015
31 264206 UTSW Togaram1 0.745 R3124 G1 225 Y 12 64966344 R123L G T missense Het probably damaging 0.999 0.241 02/05/2015
32 264211 UTSW Trappc9 0.000 R3124 G1 225 Y 15 73025967 R377W G A missense Het probably damaging 0.999 0.647 phenotype 02/05/2015
33 264197 UTSW Trim12a 0.058 R3124 G1 225 Y 7 104300856 T292K G T missense Het probably benign 0.370 0.325 02/05/2015
34 264207 UTSW Trim9 0.326 R3124 G1 225 Y 12 70248393 G648R C T missense Het probably damaging 1.000 0.831 phenotype 02/05/2015
35 264189 UTSW Trmt13 0.162 R3124 G1 225 Y 3 116590244 I104V T C missense Het probably benign 0.001 0.058 02/05/2015
36 264188 UTSW Vav3 0.204 R3124 G1 225 Y 3 109628168 G A critical splice donor site 1 bp Het probably null 0.948 phenotype 02/05/2015
37 264195 UTSW Vmn1r87 0.057 R3124 G1 225 Y 7 13131566 Y265H A G missense Het probably damaging 0.998 0.647 02/05/2015
38 264196 UTSW Zfp574 0.959 R3124 G1 139 Y 7 25081601 A683S G T missense Het possibly damaging 0.875 0.087 02/05/2015
[records 1 to 38 of 38]