Incidental Mutations

43 incidental mutations are currently displayed, and affect 43 genes.
12 are Possibly Damaging.
13 are Probably Damaging.
12 are Probably Benign.
6 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 43 of 43] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 271625 UTSW 9530053A07Rik 0.089 R3150 G1 225 N 7 28154195 T1528N C A missense Het probably benign 0.210 03/25/2015
2 271618 UTSW Akna 0.088 R3150 G1 225 N 4 63395353 S178T A T missense Het possibly damaging 0.802 phenotype 03/25/2015
3 271644 UTSW BC067074 0.224 R3150 G1 225 N 13 113351760 Q105H A T missense Het probably damaging 1.000 03/25/2015
4 271636 UTSW Cabin1 1.000 R3150 G1 217 N 10 75656911 L1850P A G missense Het probably damaging 1.000 phenotype 03/25/2015
5 271653 UTSW Ccdc178 0.000 R3150 G1 225 N 18 22067652 A416E G T missense Het possibly damaging 0.953 0.147 03/25/2015
6 271631 UTSW Ces1g 0.057 R3150 G1 225 N 8 93325816 V282I C T missense Het probably benign 0.450 phenotype 03/25/2015
7 271612 UTSW Col4a3 0.000 R3150 G1 225 N 1 82657137 T G splice site Het probably null phenotype 03/25/2015
8 473500 UTSW Crat 0.186 R3150 G1 225 N 2 30413859 C T critical splice donor site 1 bp Het probably null phenotype 04/14/2017
9 271656 UTSW Csf2ra 0.081 R3150 G1 225 N 19 61227320 A16S C A missense Het possibly damaging 0.828 phenotype 03/25/2015
10 271630 UTSW Cyp4f18 0.000 R3150 G1 225 N 8 71993200 D317G T C missense Het possibly damaging 0.693 0.179 phenotype 03/25/2015
11 271654 UTSW Ddb1 1.000 R3150 G1 225 N 19 10612982 M291K T A missense Het probably benign 0.022 phenotype 03/25/2015
12 271632 UTSW Gfod2 0.000 R3150 G1 225 N 8 105717221 G230D C T missense Het probably benign 0.000 03/25/2015
13 271622 UTSW Git2 0.307 R3150 G1 225 N 5 114730349 S257P A G missense Het probably damaging 0.996 phenotype 03/25/2015
14 271628 UTSW Gm5592 0.064 R3150 G1 225 N 7 41288380 E362G A G missense Het probably benign 0.001 0.090 03/25/2015
15 271642 UTSW Gpatch2l 0.000 R3150 G1 223 N 12 86244315 T91A A G missense Het possibly damaging 0.760 0.070 03/25/2015
16 473499 UTSW Hjurp 0.853 R3150 G1 88 N 1 88266561 A G utr 3 prime Het probably benign 04/14/2017
17 271638 UTSW Hnrnph1 1.000 R3150 G1 225 N 11 50385792 V439E T A missense Het probably benign 0.000 phenotype 03/25/2015
18 271629 UTSW Itgad 0.064 R3150 G1 225 N 7 128190981 H651N C A missense Het possibly damaging 0.638 0.179 phenotype 03/25/2015
19 271614 UTSW Map3k20 0.000 R3150 G1 225 N 2 72371992 T189M C T missense Het probably damaging 0.998 phenotype 03/25/2015
20 271646 UTSW Mapk11 0.000 R3150 G1 225 N 15 89145450 T C splice site Het probably null phenotype 03/25/2015
21 271641 UTSW Mrc2 0.000 R3150 G1 225 N 11 105348431 G A splice site 5 bp Het probably null 0.976 phenotype 03/25/2015
22 271647 UTSW Nmral1 0.000 R3150 G1 225 N 16 4716469 T36I G A missense Het probably damaging 1.000 phenotype 03/25/2015
23 271615 UTSW Olfr1231 0.077 R3150 G1 225 N 2 89303218 V125M C T missense Het possibly damaging 0.824 0.179 phenotype 03/25/2015
24 271655 UTSW Olfr1475 0.105 R3150 G1 225 N 19 13479460 V246A A G missense Het probably damaging 1.000 phenotype 03/25/2015
25 271633 UTSW Olfr860 0.058 R3150 G1 225 N 9 19846214 I135T A G missense Het possibly damaging 0.795 phenotype 03/25/2015
26 271620 UTSW Padi6 0.000 R3150 G1 225 N 4 140735389 L307P A G missense Het probably damaging 1.000 0.150 phenotype 03/25/2015
27 271650 UTSW Pkd1 1.000 R3150 G1 218 N 17 24579791 R2691L G T missense Het probably benign 0.001 phenotype 03/25/2015
28 271645 UTSW Ppp2r2a 1.000 R3150 G1 225 N 14 67023765 R169W G A missense Het probably damaging 1.000 phenotype 03/25/2015
29 271635 UTSW Prdm1 1.000 R3150 G1 225 N 10 44458492 A T splice site Het probably null phenotype 03/25/2015
30 271649 UTSW Robo1 1.000 R3150 G1 225 N 16 72970269 P443L C T missense Het possibly damaging 0.570 phenotype 03/25/2015
31 271637 UTSW Rtn4 0.796 R3150 G1 143 N 11 29693308 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 03/25/2015
32 271634 UTSW Shprh 0.000 R3150 G1 225 N 10 11170030 H865R A G missense Het probably damaging 0.970 Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators] (source: MGI)">phenotype 03/25/2015
33 271651 UTSW Spats1 0.000 R3150 G1 225 N 17 45464554 S15T A T missense Het probably damaging 0.999 03/25/2015
34 271613 UTSW Srgap2 0.000 R3150 G1 225 N 1 131292589 T216A T C missense Het probably benign 0.001 phenotype 03/25/2015
35 271657 UTSW Sry 0.318 R3150 G1 102 N Y 2662944 ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 03/25/2015
36 271619 UTSW Tie1 1.000 R3150 G1 225 N 4 118475825 A902V G A missense Het probably damaging 0.996 phenotype 03/25/2015
37 271639 UTSW Usp22 1.000 R3150 G1 225 N 11 61160581 Q312R T C missense Het probably damaging 0.975 phenotype 03/25/2015
38 271623 UTSW Vmn2r32 0.197 R3150 G1 116 N 7 7472555 Y443C T C missense Het probably benign 0.000 03/25/2015
39 271621 UTSW Vps13d 1.000 R3150 G1 225 N 4 145086790 D3274E A C missense Het probably damaging 0.982 phenotype 03/25/2015
40 271626 UTSW Wdr62 0.000 R3150 G1 225 N 7 30271670 N167K A T missense Het possibly damaging 0.940 phenotype 03/25/2015
41 271652 UTSW Xpo5 1.000 R3150 G1 225 N 17 46242247 A G splice site Het probably null phenotype 03/25/2015
42 271640 UTSW Zswim7 0.164 R3150 G1 225 N 11 62273785 I43N A T missense Het possibly damaging 0.502 03/25/2015
43 271624 UTSW Zswim9 0.066 R3150 G1 225 N 7 13277270 T51A T C missense Het possibly damaging 0.944 0.179 03/25/2015
[records 1 to 43 of 43]