Incidental Mutations

35 incidental mutations are currently displayed, and affect 35 genes.
7 are Possibly Damaging.
8 are Probably Damaging.
16 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 35 of 35] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 263592 UTSW Aoc2 0.269 R3158 G1 225 Y 11 101329276 N696I A T missense Het probably damaging 1.000 0.745 phenotype 02/05/2015
2 263587 UTSW Ccr4 0.000 R3158 G1 225 Y 9 114492282 N238K G T missense Het probably benign 0.044 0.083 phenotype 02/05/2015
3 263594 UTSW Cd300e 0.000 R3158 G1 225 Y 11 115062023 M1R A C start codon destroyed Het probably null 0.915 phenotype 02/05/2015
4 263593 UTSW Cep95 0.136 R3158 G1 225 Y 11 106809187 A G splice site Het probably benign 0.090 02/05/2015
5 263590 UTSW Cfap54 0.096 R3158 G1 225 Y 10 92999056 I1096V T C missense Het probably benign 0.029 0.089 phenotype 02/05/2015
6 263577 UTSW Clca4b 0.084 R3158 G1 225 Y 3 144912117 V742L C A missense Het probably benign 0.042 0.124 phenotype 02/05/2015
7 263600 UTSW Diaph3 1.000 R3158 G1 225 Y 14 86656456 I39N A T missense Het possibly damaging 0.841 0.058 phenotype 02/05/2015
8 263584 UTSW Dll3 0.505 R3158 G1 225 Y 7 28294095 D566E A T missense Het possibly damaging 0.499 0.060 phenotype 02/05/2015
9 263583 UTSW Dmpk 0.545 R3158 G1 188 Y 7 19093019 T579A A G missense Het probably benign 0.001 0.090 phenotype 02/05/2015
10 263596 UTSW E330034G19Rik 0.176 R3158 G1 225 Y 14 24296897 Y84F A T missense Het possibly damaging 0.787 0.179 02/05/2015
11 263573 UTSW Eya1 0.848 R3158 G1 225 Y 1 14304467 G A start gained Het probably benign 0.064 phenotype 02/05/2015
12 263575 UTSW Fat4 1.000 R3158 G1 225 Y 3 38890791 T1278A A G missense Het possibly damaging 0.870 0.127 phenotype 02/05/2015
13 263579 UTSW Galnt12 0.000 R3158 G1 225 Y 4 47104264 D174G A G missense Het probably damaging 0.995 0.239 phenotype 02/05/2015
14 348330 UTSW Gm20939 0.073 R3158 G1 49 Y 17 94877293 H456Q T A missense Het probably damaging 1.000 0.647 10/08/2015
15 263597 UTSW Gm7853 0.088 R3158 G1 225 Y 14 36089401 A G exon Het noncoding transcript 02/05/2015
16 263576 UTSW Hsd3b5 0.070 R3158 G1 225 Y 3 98622059 A85V G A missense Het probably benign 0.001 0.090 02/05/2015
17 263586 UTSW Itga11 0.115 R3158 G1 147 Y 9 62769278 K916R A G missense Het probably benign 0.017 0.083 phenotype 02/05/2015
18 263603 UTSW Kcnh8 0.000 R3158 G1 182 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.090 phenotype 02/05/2015
19 263602 UTSW Krt6a 0.277 R3158 G1 225 Y 15 101691366 Y437C T C missense Het probably damaging 1.000 0.964 phenotype 02/05/2015
20 263604 UTSW Lrp5 0.903 R3158 G1 225 Y 19 3615849 S707P A G missense Het probably damaging 0.970 0.380 phenotype 02/05/2015
21 263606 UTSW Med14 0.947 R3158 G1 222 Y X 12684091 G A splice site Het probably benign phenotype 02/05/2015
22 263588 UTSW Mmp11 0.000 R3158 G1 225 Y 10 75927114 C T unclassified Het probably benign 0.090 phenotype 02/05/2015
23 263580 UTSW Mtus2 0.115 R3158 G1 225 Y 5 148231827 H950R A G missense Het probably damaging 0.999 0.199 02/05/2015
24 263591 UTSW Myo1g 0.000 R3158 G1 225 Y 11 6514527 T511K G T missense Het possibly damaging 0.618 0.079 phenotype 02/05/2015
25 263585 UTSW Myo7a 0.000 R3158 G1 225 Y 7 98052292 F2154S A G missense Het probably damaging 1.000 0.930 phenotype 02/05/2015
26 263574 UTSW Olfr1098 0.060 R3158 G1 225 Y 2 86922606 E309K C T missense Het probably benign 0.000 0.090 phenotype 02/05/2015
27 263605 UTSW Olfr1453 0.066 R3158 G1 225 Y 19 13028047 A94G G C missense Het probably benign 0.027 0.093 phenotype 02/05/2015
28 263598 UTSW Olfr749 0.064 R3158 G1 225 Y 14 50736814 V116A A G missense Het probably benign 0.008 0.147 phenotype 02/05/2015
29 263599 UTSW Prss52 0.000 R3158 G1 225 Y 14 64113543 W259L G T missense Het probably damaging 1.000 0.647 02/05/2015
30 263581 UTSW Sbk2 0.000 R3158 G1 225 Y 7 4957527 R215* G A nonsense Het probably null 0.976 02/05/2015
31 263595 UTSW Sectm1a 0.061 R3158 G1 225 Y 11 121068777 I175T A G missense Het probably benign 0.189 0.090 phenotype 02/05/2015
32 263578 UTSW Smu1 0.952 R3158 G1 225 Y 4 40754529 R123S T A missense Het possibly damaging 0.819 0.179 02/05/2015
33 263601 UTSW Stk3 0.000 R3158 G1 225 Y 15 35008241 S178P A G missense Het possibly damaging 0.832 0.729 phenotype 02/05/2015
34 263589 UTSW Tle6 0.261 R3158 G1 225 Y 10 81595204 T C splice site 4 bp Het probably null phenotype 02/05/2015
35 263582 UTSW Vmn2r37 0.085 R3158 G1 112 N 7 9217714 M383I C T missense Het probably benign 0.026 02/05/2015
[records 1 to 35 of 35]