Incidental Mutations

39 incidental mutations are currently displayed, and affect 39 genes.
8 are Possibly Damaging.
14 are Probably Damaging.
14 are Probably Benign.
3 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 39 of 39] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 267780 UTSW Adarb2 0.000 R3412 G1 225 Y 13 8752618 F643S T C missense Het probably damaging 0.999 0.646 phenotype 02/18/2015
2 267771 UTSW Ap2a2 0.443 R3412 G1 225 Y 7 141598776 N105K T A missense Het probably benign 0.045 0.240 phenotype 02/18/2015
3 267764 UTSW Arhgef5 0.000 R3412 G1 225 Y 6 43273790 I492V A G missense Het probably benign 0.000 0.090 phenotype 02/18/2015
4 267753 UTSW Atp8b4 0.070 R3412 G1 225 Y 2 126375757 W613L C A missense Het probably damaging 1.000 0.802 phenotype 02/18/2015
5 267775 UTSW Ccdc162 0.095 R3412 G1 225 Y 10 41539549 T C splice site Het probably benign 02/18/2015
6 267750 UTSW Diexf 0.967 R3412 G1 204 Y 1 193128502 S64R A C missense Het possibly damaging 0.931 0.071 02/18/2015
7 267783 UTSW Esp24 0.087 R3412 G1 225 Y 17 39038316 I11N T A missense Het possibly damaging 0.730 0.179 02/18/2015
8 267763 UTSW Exoc4 1.000 R3412 G1 225 Y 6 33265975 E41G A G missense Het probably damaging 0.997 0.371 phenotype 02/18/2015
9 267747 UTSW Eya1 0.904 R3412 G1 225 Y 1 14274209 T A critical splice acceptor site Het probably null 0.972 phenotype 02/18/2015
10 267759 UTSW Gckr 0.000 R3412 G1 225 Y 5 31300867 T A critical splice donor site 2 bp Het probably null 0.948 phenotype 02/18/2015
11 267776 UTSW Gm4981 0.093 R3412 G1 225 Y 10 58236353 T13I G A missense Het possibly damaging 0.931 0.179 02/18/2015
12 267772 UTSW Gria4 0.701 R3412 G1 225 Y 9 4513278 D277V T A missense Het probably benign 0.004 0.091 phenotype 02/18/2015
13 267748 UTSW Il18r1 0.000 R3412 G1 185 Y 1 40491067 D318V A T missense Het probably damaging 1.000 0.553 phenotype 02/18/2015
14 267765 UTSW Il4i1 0.000 R3412 G1 225 Y 7 44836658 L22P T C missense Het probably damaging 0.992 0.638 phenotype 02/18/2015
15 267749 UTSW Inpp5d 0.911 R3412 G1 225 Y 1 87668057 T175N C A missense Het possibly damaging 0.928 0.103 phenotype 02/18/2015
16 267782 UTSW Krt90 0.000 R3412 G1 225 Y 15 101560593 L171F T A missense Het probably damaging 1.000 0.647 phenotype 02/18/2015
17 267779 UTSW Mthfd1 1.000 R3412 G1 225 Y 12 76303749 A G splice site 4 bp Het probably null 0.976 phenotype 02/18/2015
18 267785 UTSW Olfr262 0.109 R3412 G1 225 Y 19 12241590 I24V T C missense Het probably benign 0.002 0.314 phenotype 02/18/2015
19 267766 UTSW Olfr561 0.087 R3412 G1 225 Y 7 102774755 L77P T C missense Het possibly damaging 0.775 0.179 phenotype 02/18/2015
20 267767 UTSW Olfr635 0.120 R3412 G1 225 Y 7 103979402 L76P T C missense Het probably damaging 0.978 0.235 phenotype 02/18/2015
21 267777 UTSW Olfr786 0.088 R3412 G1 225 Y 10 129437307 D165V A T missense Het probably damaging 0.986 0.647 phenotype 02/18/2015
22 267751 UTSW Pla2g4f 0.062 R3412 G1 188 Y 2 120303106 S579G T C missense Het probably benign 0.000 0.093 02/18/2015
23 267761 UTSW Ppef2 0.000 R3412 G1 225 Y 5 92228722 S649R T G missense Het probably damaging 0.967 0.089 phenotype 02/18/2015
24 267774 UTSW Prss43 0.068 R3412 G1 225 Y 9 110829464 Q277H G C missense Het probably damaging 0.996 0.647 02/18/2015
25 267778 UTSW Ramp2 1.000 R3412 G1 107 Y 11 101246545 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG unclassified Het probably benign phenotype 02/18/2015
26 267756 UTSW Rusc2 0.253 R3412 G1 225 Y 4 43415935 S414A T G missense Het probably damaging 1.000 0.102 phenotype 02/18/2015
27 267762 UTSW Sez6l 0.000 R3412 G1 225 Y 5 112475361 L108P A G missense Het possibly damaging 0.764 0.179 phenotype 02/18/2015
28 267754 UTSW Slc12a5 1.000 R3412 G1 99 Y 2 164968431 D10G A G missense Het probably benign 0.258 0.061 phenotype 02/18/2015
29 267758 UTSW Slc1a7 0.084 R3412 G1 225 Y 4 108010994 E497G A G missense Het probably benign 0.023 0.076 02/18/2015
30 267784 UTSW Sos1 1.000 R3412 G1 225 Y 17 80406717 D1108G T C missense Het probably benign 0.000 0.059 phenotype 02/18/2015
31 267757 UTSW Spag8 0.071 R3412 G1 225 Y 4 43651606 S423C T A missense Het probably damaging 1.000 0.178 phenotype 02/18/2015
32 267770 UTSW Tacc2 0.000 R3412 G1 225 Y 7 130734994 T2369A A G missense Het probably benign 0.021 0.090 phenotype 02/18/2015
33 267768 UTSW Taok2 0.000 R3412 G1 225 Y 7 126870858 I933V T C missense Het possibly damaging 0.785 0.064 phenotype 02/18/2015
34 267773 UTSW Tex9 0.096 R3412 G1 225 Y 9 72477758 Q265H C A missense Het possibly damaging 0.890 0.179 02/18/2015
35 267752 UTSW Trim69 0.069 R3412 G1 225 Y 2 122178644 V395A T C missense Het probably benign 0.049 0.315 phenotype 02/18/2015
36 353158 UTSW Tusc1 0.000 R3412 G1 53 Y 4 93334936 R162L C A missense Het probably damaging 0.992 0.364 phenotype 10/16/2015
37 267781 UTSW Ubr5 1.000 R3412 G1 225 Y 15 38004235 T C splice site Het probably benign 0.090 phenotype 02/18/2015
38 267760 UTSW Zfyve28 0.000 R3412 G1 225 Y 5 34199684 M723I C T missense Het probably benign 0.017 0.090 02/18/2015
39 267755 UTSW Zmynd8 1.000 R3412 G1 225 Y 2 165815451 M533K A T missense Het probably damaging 0.997 0.106 phenotype 02/18/2015
[records 1 to 39 of 39]