Incidental Mutations

44 incidental mutations are currently displayed, and affect 44 genes.
3 are Possibly Damaging.
26 are Probably Damaging.
9 are Probably Benign.
3 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 44 of 44] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 269120 UTSW 4930510E17Rik 0.163 R3607 G1 225 Y 9 53279783 C A exon Het noncoding transcript 02/19/2015
2 269144 UTSW Adnp2 1.000 R3607 G1 200 Y 18 80129069 N708K A T missense Het probably damaging 1.000 0.647 02/19/2015
3 269114 UTSW Arhgef17 0.000 R3607 G1 225 Y 7 100931172 G190W C A missense Het probably damaging 1.000 0.129 02/19/2015
4 269100 UTSW Aspm 0.000 R3607 G1 225 Y 1 139480668 M2431K T A missense Het probably benign 0.127 0.134 phenotype 02/19/2015
5 269110 UTSW Aurkc 0.000 R3607 G1 131 Y 7 7002860 Y157C A G missense Het probably damaging 0.999 0.138 phenotype 02/19/2015
6 269103 UTSW Bpifb1 0.000 R3607 G1 225 Y 2 154211565 N242K T A missense Het possibly damaging 0.783 0.179 phenotype 02/19/2015
7 269115 UTSW Cracr2b 0.080 R3607 G1 215 Y 7 141466146 P370S C T missense Het possibly damaging 0.930 0.117 02/19/2015
8 269132 UTSW Etv1 0.578 R3607 G1 225 Y 12 38831086 Y66C A G missense Het probably damaging 1.000 0.810 phenotype 02/19/2015
9 269143 UTSW F830016B08Rik 0.063 R3607 G1 225 Y 18 60300708 K288* A T nonsense Het probably null 0.976 02/19/2015
10 269136 UTSW Fam131a 0.099 R3607 G1 154 Y 16 20701595 P181L C T missense Het probably damaging 1.000 0.182 02/19/2015
11 269127 UTSW Fat2 0.000 R3607 G1 225 Y 11 55281685 E2734V T A missense Het probably damaging 1.000 0.395 phenotype 02/19/2015
12 269108 UTSW Fgfrl1 1.000 R3607 G1 206 Y 5 108705423 T213K C A missense Het probably damaging 0.960 0.307 phenotype 02/19/2015
13 269124 UTSW Gm10608 0.082 R3607 G1 117 Y 9 119160716 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA small deletion Het probably benign 0.090 02/19/2015
14 269111 UTSW Gmfg R3607 G1 173 N 7 28441536 T A splice site 6 bp Het probably null 02/19/2015
15 269138 UTSW Gtpbp8 0.943 R3607 G1 225 Y 16 44743756 Y184C T C missense Het probably damaging 1.000 0.921 02/19/2015
16 269140 UTSW Heatr5b 0.279 R3607 G1 225 Y 17 78834217 E2G T C missense Het probably damaging 1.000 0.537 02/19/2015
17 269109 UTSW Itpr2 0.000 R3607 G1 225 Y 6 146227601 T2005P T G missense Het probably damaging 0.983 0.186 phenotype 02/19/2015
18 269119 UTSW Kmt2a 1.000 R3607 G1 225 Y 9 44849196 T485M G A missense Het probably damaging 0.998 0.647 phenotype 02/19/2015
19 269137 UTSW Kng1 0.000 R3607 G1 225 Y 16 23067802 F112L T C missense Het probably damaging 1.000 0.493 phenotype 02/19/2015
20 269106 UTSW Kprp 0.201 R3607 G1 225 Y 3 92824281 Q487H C A missense Het unknown 0.087 phenotype 02/19/2015
21 269121 UTSW Lctl 0.118 R3607 G1 225 Y 9 64133193 Y473H T C missense Het probably damaging 0.999 0.156 phenotype 02/19/2015
22 269139 UTSW Lpin2 0.383 R3607 G1 225 Y 17 71229392 D225E T A missense Het probably damaging 1.000 0.103 phenotype 02/19/2015
23 269116 UTSW Myom2 0.139 R3607 G1 225 Y 8 15069775 V177A T C missense Het probably damaging 1.000 0.461 phenotype 02/19/2015
24 269146 UTSW Nkrf 0.000 R3607 G1 225 Y X 36890077 N184T T G missense Het probably benign 0.022 0.058 phenotype 02/19/2015
25 269130 UTSW Nt5c1b 0.000 R3607 G1 225 Y 12 10377236 N329D A G missense Het probably damaging 1.000 0.480 phenotype 02/19/2015
26 269135 UTSW Ogdhl 0.000 R3607 G1 225 Y 14 32335361 V308E T A missense Het probably damaging 1.000 0.946 phenotype 02/19/2015
27 269113 UTSW Olfr304 0.088 R3607 G1 225 Y 7 86385695 C322R A G missense Het probably benign 0.000 0.090 phenotype 02/19/2015
28 269133 UTSW Pcnx 0.000 R3607 G1 201 Y 12 81928292 F791I T A missense Het probably damaging 1.000 0.078 phenotype 02/19/2015
29 269107 UTSW Prkg2 0.222 R3607 G1 225 Y 5 98947377 T616K G T missense Het probably damaging 0.999 0.822 phenotype 02/19/2015
30 269128 UTSW Psmd3 0.954 R3607 G1 225 Y 11 98690954 R302W C T missense Het probably damaging 0.996 0.330 phenotype 02/19/2015
31 269105 UTSW Ptpn1 0.892 R3607 G1 200 Y 2 167975507 S355G A G missense Het probably benign 0.000 0.090 phenotype 02/19/2015
32 269131 UTSW Pxdn 0.511 R3607 G1 225 Y 12 29990918 N398D A G missense Het probably benign 0.038 0.269 phenotype 02/19/2015
33 269117 UTSW Ranbp10 0.000 R3607 G1 225 Y 8 105776035 S300P A G missense Het probably benign 0.395 0.090 phenotype 02/19/2015
34 269104 UTSW Rbl1 0.000 R3607 G1 225 Y 2 157177233 F531I A T missense Het probably damaging 0.999 0.860 phenotype 02/19/2015
35 269118 UTSW Rgl3 0.000 R3607 G1 225 Y 9 21987691 S151P A G missense Het probably damaging 0.978 0.647 02/19/2015
36 269129 UTSW Rnf213 0.000 R3607 G1 225 Y 11 119441976 C2670* C A nonsense Het probably null 0.976 phenotype 02/19/2015
37 269147 UTSW Tex16 0.086 R3607 G1 222 Y X 112093970 S159T T A missense Het probably damaging 0.998 0.647 02/19/2015
38 269125 UTSW Tnfaip3 0.000 R3607 G1 225 Y 10 19005602 I312T A G missense Het probably damaging 1.000 0.301 phenotype 02/19/2015
39 269101 UTSW Traf2 1.000 R3607 G1 225 Y 2 25530415 T141A T C missense Het probably benign 0.017 0.077 phenotype 02/19/2015
40 473143 UTSW Trpm7 1.000 R3607 G1 225 N 2 126796428 T C intron Het probably benign phenotype 04/14/2017
41 269145 UTSW Usp11 0.000 R3607 G1 225 Y X 20714632 F426L T G missense Het probably damaging 1.000 0.647 phenotype 02/19/2015
42 269134 UTSW Vcan 1.000 R3607 G1 225 Y 13 89703301 T1180K G T missense Het probably damaging 0.981 0.141 phenotype 02/19/2015
43 269126 UTSW Wasf1 0.503 R3607 G1 225 Y 10 40936384 A390P G C missense Het unknown 0.092 phenotype 02/19/2015
44 269112 UTSW Yif1b 0.114 R3607 G1 225 Y 7 29238410 A7V C T missense Het possibly damaging 0.845 0.106 02/19/2015
[records 1 to 44 of 44]